ID: 1046227985

View in Genome Browser
Species Human (GRCh38)
Location 8:111311216-111311238
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046227985_1046227994 21 Left 1046227985 8:111311216-111311238 CCACCACCAACTTGCTCTTTGTC No data
Right 1046227994 8:111311260-111311282 TAAGGACTTATGAGGTACCTTGG No data
1046227985_1046227988 3 Left 1046227985 8:111311216-111311238 CCACCACCAACTTGCTCTTTGTC No data
Right 1046227988 8:111311242-111311264 GCCTCCTACCCTCTCTATTAAGG No data
1046227985_1046227995 22 Left 1046227985 8:111311216-111311238 CCACCACCAACTTGCTCTTTGTC No data
Right 1046227995 8:111311261-111311283 AAGGACTTATGAGGTACCTTGGG No data
1046227985_1046227993 13 Left 1046227985 8:111311216-111311238 CCACCACCAACTTGCTCTTTGTC No data
Right 1046227993 8:111311252-111311274 CTCTCTATTAAGGACTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046227985 Original CRISPR GACAAAGAGCAAGTTGGTGG TGG (reversed) Intergenic