ID: 1046227989

View in Genome Browser
Species Human (GRCh38)
Location 8:111311243-111311265
Sequence TCCTTAATAGAGAGGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046227989_1046227999 30 Left 1046227989 8:111311243-111311265 CCTCCTACCCTCTCTATTAAGGA No data
Right 1046227999 8:111311296-111311318 TACTGCATGTAAGATGCAGTGGG No data
1046227989_1046227994 -6 Left 1046227989 8:111311243-111311265 CCTCCTACCCTCTCTATTAAGGA No data
Right 1046227994 8:111311260-111311282 TAAGGACTTATGAGGTACCTTGG No data
1046227989_1046227998 29 Left 1046227989 8:111311243-111311265 CCTCCTACCCTCTCTATTAAGGA No data
Right 1046227998 8:111311295-111311317 CTACTGCATGTAAGATGCAGTGG No data
1046227989_1046227995 -5 Left 1046227989 8:111311243-111311265 CCTCCTACCCTCTCTATTAAGGA No data
Right 1046227995 8:111311261-111311283 AAGGACTTATGAGGTACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046227989 Original CRISPR TCCTTAATAGAGAGGGTAGG AGG (reversed) Intergenic