ID: 1046227993

View in Genome Browser
Species Human (GRCh38)
Location 8:111311252-111311274
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046227987_1046227993 7 Left 1046227987 8:111311222-111311244 CCAACTTGCTCTTTGTCAAAGCC No data
Right 1046227993 8:111311252-111311274 CTCTCTATTAAGGACTTATGAGG No data
1046227985_1046227993 13 Left 1046227985 8:111311216-111311238 CCACCACCAACTTGCTCTTTGTC No data
Right 1046227993 8:111311252-111311274 CTCTCTATTAAGGACTTATGAGG No data
1046227982_1046227993 29 Left 1046227982 8:111311200-111311222 CCTTTAACCTCCTGTACCACCAC No data
Right 1046227993 8:111311252-111311274 CTCTCTATTAAGGACTTATGAGG No data
1046227984_1046227993 19 Left 1046227984 8:111311210-111311232 CCTGTACCACCACCAACTTGCTC No data
Right 1046227993 8:111311252-111311274 CTCTCTATTAAGGACTTATGAGG No data
1046227983_1046227993 22 Left 1046227983 8:111311207-111311229 CCTCCTGTACCACCACCAACTTG No data
Right 1046227993 8:111311252-111311274 CTCTCTATTAAGGACTTATGAGG No data
1046227986_1046227993 10 Left 1046227986 8:111311219-111311241 CCACCAACTTGCTCTTTGTCAAA No data
Right 1046227993 8:111311252-111311274 CTCTCTATTAAGGACTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046227993 Original CRISPR CTCTCTATTAAGGACTTATG AGG Intergenic
No off target data available for this crispr