ID: 1046227994

View in Genome Browser
Species Human (GRCh38)
Location 8:111311260-111311282
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046227985_1046227994 21 Left 1046227985 8:111311216-111311238 CCACCACCAACTTGCTCTTTGTC No data
Right 1046227994 8:111311260-111311282 TAAGGACTTATGAGGTACCTTGG No data
1046227983_1046227994 30 Left 1046227983 8:111311207-111311229 CCTCCTGTACCACCACCAACTTG No data
Right 1046227994 8:111311260-111311282 TAAGGACTTATGAGGTACCTTGG No data
1046227990_1046227994 -9 Left 1046227990 8:111311246-111311268 CCTACCCTCTCTATTAAGGACTT No data
Right 1046227994 8:111311260-111311282 TAAGGACTTATGAGGTACCTTGG No data
1046227984_1046227994 27 Left 1046227984 8:111311210-111311232 CCTGTACCACCACCAACTTGCTC No data
Right 1046227994 8:111311260-111311282 TAAGGACTTATGAGGTACCTTGG No data
1046227989_1046227994 -6 Left 1046227989 8:111311243-111311265 CCTCCTACCCTCTCTATTAAGGA No data
Right 1046227994 8:111311260-111311282 TAAGGACTTATGAGGTACCTTGG No data
1046227986_1046227994 18 Left 1046227986 8:111311219-111311241 CCACCAACTTGCTCTTTGTCAAA No data
Right 1046227994 8:111311260-111311282 TAAGGACTTATGAGGTACCTTGG No data
1046227987_1046227994 15 Left 1046227987 8:111311222-111311244 CCAACTTGCTCTTTGTCAAAGCC No data
Right 1046227994 8:111311260-111311282 TAAGGACTTATGAGGTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046227994 Original CRISPR TAAGGACTTATGAGGTACCT TGG Intergenic