ID: 1046228923

View in Genome Browser
Species Human (GRCh38)
Location 8:111327194-111327216
Sequence CATGACTAACTAGCAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046228923_1046228926 9 Left 1046228923 8:111327194-111327216 CCTGTCTTTGCTAGTTAGTCATG No data
Right 1046228926 8:111327226-111327248 AAGTTAATATGTGGATGACTTGG No data
1046228923_1046228924 0 Left 1046228923 8:111327194-111327216 CCTGTCTTTGCTAGTTAGTCATG No data
Right 1046228924 8:111327217-111327239 AATTCCAACAAGTTAATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046228923 Original CRISPR CATGACTAACTAGCAAAGAC AGG (reversed) Intergenic
No off target data available for this crispr