ID: 1046233126

View in Genome Browser
Species Human (GRCh38)
Location 8:111384085-111384107
Sequence CCTGGGATTTTTGGTGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046233120_1046233126 25 Left 1046233120 8:111384037-111384059 CCAATTCTTCTTTGAATGTCTGG 0: 241
1: 495
2: 483
3: 430
4: 831
Right 1046233126 8:111384085-111384107 CCTGGGATTTTTGGTGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046233126 Original CRISPR CCTGGGATTTTTGGTGTTGT TGG Intergenic
No off target data available for this crispr