ID: 1046234055

View in Genome Browser
Species Human (GRCh38)
Location 8:111398185-111398207
Sequence ATTAGGGCCCACCGTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046234048_1046234055 15 Left 1046234048 8:111398147-111398169 CCTTATCTTAGTGCACCTAAAGG No data
Right 1046234055 8:111398185-111398207 ATTAGGGCCCACCGTTTTACTGG No data
1046234052_1046234055 0 Left 1046234052 8:111398162-111398184 CCTAAAGGGAAAGGAATGTGCTT No data
Right 1046234055 8:111398185-111398207 ATTAGGGCCCACCGTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046234055 Original CRISPR ATTAGGGCCCACCGTTTTAC TGG Intergenic
No off target data available for this crispr