ID: 1046249506

View in Genome Browser
Species Human (GRCh38)
Location 8:111611760-111611782
Sequence CTCCCCGCCTGGCTTGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046249506_1046249510 -8 Left 1046249506 8:111611760-111611782 CCGAGGGCAAGCCAGGCGGGGAG No data
Right 1046249510 8:111611775-111611797 GCGGGGAGTGGTGAGGTATGTGG No data
1046249506_1046249513 10 Left 1046249506 8:111611760-111611782 CCGAGGGCAAGCCAGGCGGGGAG No data
Right 1046249513 8:111611793-111611815 TGTGGGAATGAGTGAGTCCAGGG No data
1046249506_1046249511 -7 Left 1046249506 8:111611760-111611782 CCGAGGGCAAGCCAGGCGGGGAG No data
Right 1046249511 8:111611776-111611798 CGGGGAGTGGTGAGGTATGTGGG No data
1046249506_1046249512 9 Left 1046249506 8:111611760-111611782 CCGAGGGCAAGCCAGGCGGGGAG No data
Right 1046249512 8:111611792-111611814 ATGTGGGAATGAGTGAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046249506 Original CRISPR CTCCCCGCCTGGCTTGCCCT CGG (reversed) Intergenic
No off target data available for this crispr