ID: 1046255710

View in Genome Browser
Species Human (GRCh38)
Location 8:111694179-111694201
Sequence CACTGCTGTCCCAAGCTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046255706_1046255710 -4 Left 1046255706 8:111694160-111694182 CCAGTGGGTAGGGCTACTACACT No data
Right 1046255710 8:111694179-111694201 CACTGCTGTCCCAAGCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046255710 Original CRISPR CACTGCTGTCCCAAGCTAGG GGG Intergenic
No off target data available for this crispr