ID: 1046258729

View in Genome Browser
Species Human (GRCh38)
Location 8:111737414-111737436
Sequence TTTTGCATCAATTTACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046258729_1046258734 29 Left 1046258729 8:111737414-111737436 CCTTCCTGTAAATTGATGCAAAA No data
Right 1046258734 8:111737466-111737488 ACTGAGAAGTGAGATGAGGAGGG No data
1046258729_1046258732 25 Left 1046258729 8:111737414-111737436 CCTTCCTGTAAATTGATGCAAAA No data
Right 1046258732 8:111737462-111737484 ATTCACTGAGAAGTGAGATGAGG No data
1046258729_1046258733 28 Left 1046258729 8:111737414-111737436 CCTTCCTGTAAATTGATGCAAAA No data
Right 1046258733 8:111737465-111737487 CACTGAGAAGTGAGATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046258729 Original CRISPR TTTTGCATCAATTTACAGGA AGG (reversed) Intergenic
No off target data available for this crispr