ID: 1046258734

View in Genome Browser
Species Human (GRCh38)
Location 8:111737466-111737488
Sequence ACTGAGAAGTGAGATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046258729_1046258734 29 Left 1046258729 8:111737414-111737436 CCTTCCTGTAAATTGATGCAAAA No data
Right 1046258734 8:111737466-111737488 ACTGAGAAGTGAGATGAGGAGGG No data
1046258730_1046258734 25 Left 1046258730 8:111737418-111737440 CCTGTAAATTGATGCAAAACTTA No data
Right 1046258734 8:111737466-111737488 ACTGAGAAGTGAGATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046258734 Original CRISPR ACTGAGAAGTGAGATGAGGA GGG Intergenic
No off target data available for this crispr