ID: 1046260642

View in Genome Browser
Species Human (GRCh38)
Location 8:111763273-111763295
Sequence GTAGAGATGGTAAAATGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046260640_1046260642 -6 Left 1046260640 8:111763256-111763278 CCTAAAAAAGCATTACTGTAGAG No data
Right 1046260642 8:111763273-111763295 GTAGAGATGGTAAAATGATCAGG No data
1046260639_1046260642 10 Left 1046260639 8:111763240-111763262 CCAATTATATGATATTCCTAAAA No data
Right 1046260642 8:111763273-111763295 GTAGAGATGGTAAAATGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046260642 Original CRISPR GTAGAGATGGTAAAATGATC AGG Intergenic
No off target data available for this crispr