ID: 1046260644

View in Genome Browser
Species Human (GRCh38)
Location 8:111763308-111763330
Sequence GAATTGCATAATTGAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046260640_1046260644 29 Left 1046260640 8:111763256-111763278 CCTAAAAAAGCATTACTGTAGAG No data
Right 1046260644 8:111763308-111763330 GAATTGCATAATTGAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046260644 Original CRISPR GAATTGCATAATTGAAGAAC AGG Intergenic
No off target data available for this crispr