ID: 1046260910

View in Genome Browser
Species Human (GRCh38)
Location 8:111766201-111766223
Sequence TCAGCTTAGCTGTCCGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046260910_1046260914 8 Left 1046260910 8:111766201-111766223 CCACCTGCGGACAGCTAAGCTGA No data
Right 1046260914 8:111766232-111766254 ACTGTTACACACGCCTGTTGGGG No data
1046260910_1046260913 7 Left 1046260910 8:111766201-111766223 CCACCTGCGGACAGCTAAGCTGA No data
Right 1046260913 8:111766231-111766253 CACTGTTACACACGCCTGTTGGG No data
1046260910_1046260912 6 Left 1046260910 8:111766201-111766223 CCACCTGCGGACAGCTAAGCTGA No data
Right 1046260912 8:111766230-111766252 ACACTGTTACACACGCCTGTTGG No data
1046260910_1046260915 14 Left 1046260910 8:111766201-111766223 CCACCTGCGGACAGCTAAGCTGA No data
Right 1046260915 8:111766238-111766260 ACACACGCCTGTTGGGGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046260910 Original CRISPR TCAGCTTAGCTGTCCGCAGG TGG (reversed) Intergenic