ID: 1046260913

View in Genome Browser
Species Human (GRCh38)
Location 8:111766231-111766253
Sequence CACTGTTACACACGCCTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046260911_1046260913 4 Left 1046260911 8:111766204-111766226 CCTGCGGACAGCTAAGCTGAAAG No data
Right 1046260913 8:111766231-111766253 CACTGTTACACACGCCTGTTGGG No data
1046260910_1046260913 7 Left 1046260910 8:111766201-111766223 CCACCTGCGGACAGCTAAGCTGA No data
Right 1046260913 8:111766231-111766253 CACTGTTACACACGCCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046260913 Original CRISPR CACTGTTACACACGCCTGTT GGG Intergenic