ID: 1046260914

View in Genome Browser
Species Human (GRCh38)
Location 8:111766232-111766254
Sequence ACTGTTACACACGCCTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046260911_1046260914 5 Left 1046260911 8:111766204-111766226 CCTGCGGACAGCTAAGCTGAAAG No data
Right 1046260914 8:111766232-111766254 ACTGTTACACACGCCTGTTGGGG No data
1046260910_1046260914 8 Left 1046260910 8:111766201-111766223 CCACCTGCGGACAGCTAAGCTGA No data
Right 1046260914 8:111766232-111766254 ACTGTTACACACGCCTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046260914 Original CRISPR ACTGTTACACACGCCTGTTG GGG Intergenic
No off target data available for this crispr