ID: 1046260915 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:111766238-111766260 |
Sequence | ACACACGCCTGTTGGGGCTT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1046260911_1046260915 | 11 | Left | 1046260911 | 8:111766204-111766226 | CCTGCGGACAGCTAAGCTGAAAG | 0: 2 1: 9 2: 24 3: 63 4: 140 |
||
Right | 1046260915 | 8:111766238-111766260 | ACACACGCCTGTTGGGGCTTCGG | No data | ||||
1046260910_1046260915 | 14 | Left | 1046260910 | 8:111766201-111766223 | CCACCTGCGGACAGCTAAGCTGA | No data | ||
Right | 1046260915 | 8:111766238-111766260 | ACACACGCCTGTTGGGGCTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1046260915 | Original CRISPR | ACACACGCCTGTTGGGGCTT CGG | Intergenic | ||