ID: 1046268922

View in Genome Browser
Species Human (GRCh38)
Location 8:111867258-111867280
Sequence CAAGCAATAGAGATTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046268922_1046268924 25 Left 1046268922 8:111867258-111867280 CCTGGGCAAATCTCTATTGCTTG No data
Right 1046268924 8:111867306-111867328 CTAGAAGCAGACAAAATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046268922 Original CRISPR CAAGCAATAGAGATTTGCCC AGG (reversed) Intergenic