ID: 1046271957

View in Genome Browser
Species Human (GRCh38)
Location 8:111908008-111908030
Sequence CTGGGTAAATAAAAGGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046271957_1046271961 0 Left 1046271957 8:111908008-111908030 CCTTGGACCTTTTATTTACCCAG No data
Right 1046271961 8:111908031-111908053 CTAAGATTAGAAATCATTAGAGG No data
1046271957_1046271962 20 Left 1046271957 8:111908008-111908030 CCTTGGACCTTTTATTTACCCAG No data
Right 1046271962 8:111908051-111908073 AGGATCACAAAGCCAATACTCGG No data
1046271957_1046271963 21 Left 1046271957 8:111908008-111908030 CCTTGGACCTTTTATTTACCCAG No data
Right 1046271963 8:111908052-111908074 GGATCACAAAGCCAATACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046271957 Original CRISPR CTGGGTAAATAAAAGGTCCA AGG (reversed) Intergenic
No off target data available for this crispr