ID: 1046275904

View in Genome Browser
Species Human (GRCh38)
Location 8:111959315-111959337
Sequence CACTTCAGCCTCCTGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046275900_1046275904 1 Left 1046275900 8:111959291-111959313 CCTCCTGAGCTCAAGTGATCCTC 0: 299
1: 4987
2: 15301
3: 52045
4: 101936
Right 1046275904 8:111959315-111959337 CACTTCAGCCTCCTGTAGCTGGG No data
1046275901_1046275904 -2 Left 1046275901 8:111959294-111959316 CCTGAGCTCAAGTGATCCTCTCA 0: 83
1: 2099
2: 15979
3: 54563
4: 128871
Right 1046275904 8:111959315-111959337 CACTTCAGCCTCCTGTAGCTGGG No data
1046275899_1046275904 7 Left 1046275899 8:111959285-111959307 CCTCAACCTCCTGAGCTCAAGTG 0: 83
1: 1958
2: 9697
3: 32497
4: 81046
Right 1046275904 8:111959315-111959337 CACTTCAGCCTCCTGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046275904 Original CRISPR CACTTCAGCCTCCTGTAGCT GGG Intergenic
No off target data available for this crispr