ID: 1046285180

View in Genome Browser
Species Human (GRCh38)
Location 8:112084443-112084465
Sequence ATTTCCATGGGACATAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046285176_1046285180 20 Left 1046285176 8:112084400-112084422 CCCAGTACAAAAGAAATTGAATT No data
Right 1046285180 8:112084443-112084465 ATTTCCATGGGACATAAAATAGG No data
1046285177_1046285180 19 Left 1046285177 8:112084401-112084423 CCAGTACAAAAGAAATTGAATTT No data
Right 1046285180 8:112084443-112084465 ATTTCCATGGGACATAAAATAGG No data
1046285175_1046285180 21 Left 1046285175 8:112084399-112084421 CCCCAGTACAAAAGAAATTGAAT No data
Right 1046285180 8:112084443-112084465 ATTTCCATGGGACATAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046285180 Original CRISPR ATTTCCATGGGACATAAAAT AGG Intergenic
No off target data available for this crispr