ID: 1046288872

View in Genome Browser
Species Human (GRCh38)
Location 8:112132724-112132746
Sequence TCCAGCTGGCCTGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046288872_1046288881 3 Left 1046288872 8:112132724-112132746 CCGGCGCTTGCAGGCCAGCTGGA No data
Right 1046288881 8:112132750-112132772 GCGGGCGGGCGTGGGCTTGGCGG No data
1046288872_1046288880 0 Left 1046288872 8:112132724-112132746 CCGGCGCTTGCAGGCCAGCTGGA No data
Right 1046288880 8:112132747-112132769 GTTGCGGGCGGGCGTGGGCTTGG No data
1046288872_1046288879 -5 Left 1046288872 8:112132724-112132746 CCGGCGCTTGCAGGCCAGCTGGA No data
Right 1046288879 8:112132742-112132764 CTGGAGTTGCGGGCGGGCGTGGG No data
1046288872_1046288882 24 Left 1046288872 8:112132724-112132746 CCGGCGCTTGCAGGCCAGCTGGA No data
Right 1046288882 8:112132771-112132793 GGCCCCGCACTCAGAGCAGCCGG 0: 29
1: 278
2: 382
3: 399
4: 486
1046288872_1046288886 28 Left 1046288872 8:112132724-112132746 CCGGCGCTTGCAGGCCAGCTGGA No data
Right 1046288886 8:112132775-112132797 CCGCACTCAGAGCAGCCGGCAGG No data
1046288872_1046288878 -6 Left 1046288872 8:112132724-112132746 CCGGCGCTTGCAGGCCAGCTGGA No data
Right 1046288878 8:112132741-112132763 GCTGGAGTTGCGGGCGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046288872 Original CRISPR TCCAGCTGGCCTGCAAGCGC CGG (reversed) Intergenic
No off target data available for this crispr