ID: 1046290890

View in Genome Browser
Species Human (GRCh38)
Location 8:112159405-112159427
Sequence ATAATGTGTCTGGTCAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046290890_1046290894 6 Left 1046290890 8:112159405-112159427 CCATATCTGACCAGACACATTAT No data
Right 1046290894 8:112159434-112159456 GTCTATTTAACACCTCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046290890 Original CRISPR ATAATGTGTCTGGTCAGATA TGG (reversed) Intergenic
No off target data available for this crispr