ID: 1046292562

View in Genome Browser
Species Human (GRCh38)
Location 8:112181839-112181861
Sequence TGCTATCTTTACATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046292562_1046292568 11 Left 1046292562 8:112181839-112181861 CCTTCCACCATGTAAAGATAGCA No data
Right 1046292568 8:112181873-112181895 CCATTTTGGAAGCAGTGACCTGG No data
1046292562_1046292566 -3 Left 1046292562 8:112181839-112181861 CCTTCCACCATGTAAAGATAGCA No data
Right 1046292566 8:112181859-112181881 GCACATTCAAGGTGCCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046292562 Original CRISPR TGCTATCTTTACATGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr