ID: 1046294137

View in Genome Browser
Species Human (GRCh38)
Location 8:112198155-112198177
Sequence GGTTCCACAAAGATGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046294137_1046294144 9 Left 1046294137 8:112198155-112198177 CCATGTCCCATCTTTGTGGAACC No data
Right 1046294144 8:112198187-112198209 ATCGGACTGTTCAACTCACCTGG 0: 315
1: 324
2: 125
3: 60
4: 57
1046294137_1046294140 -9 Left 1046294137 8:112198155-112198177 CCATGTCCCATCTTTGTGGAACC No data
Right 1046294140 8:112198169-112198191 TGTGGAACCCCACTGAAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046294137 Original CRISPR GGTTCCACAAAGATGGGACA TGG (reversed) Intergenic
No off target data available for this crispr