ID: 1046299011

View in Genome Browser
Species Human (GRCh38)
Location 8:112260982-112261004
Sequence GTACCTAGAAGGAGCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046299007_1046299011 18 Left 1046299007 8:112260941-112260963 CCCCTTAAATTTATAAAGTTATT 0: 1
1: 0
2: 5
3: 124
4: 1249
Right 1046299011 8:112260982-112261004 GTACCTAGAAGGAGCTCCTTTGG No data
1046299009_1046299011 16 Left 1046299009 8:112260943-112260965 CCTTAAATTTATAAAGTTATTTT 0: 1
1: 0
2: 18
3: 274
4: 2287
Right 1046299011 8:112260982-112261004 GTACCTAGAAGGAGCTCCTTTGG No data
1046299008_1046299011 17 Left 1046299008 8:112260942-112260964 CCCTTAAATTTATAAAGTTATTT 0: 1
1: 0
2: 10
3: 170
4: 1655
Right 1046299011 8:112260982-112261004 GTACCTAGAAGGAGCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046299011 Original CRISPR GTACCTAGAAGGAGCTCCTT TGG Intronic
No off target data available for this crispr