ID: 1046300962

View in Genome Browser
Species Human (GRCh38)
Location 8:112288432-112288454
Sequence ATCCCTATGAAGTGACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046300962_1046300965 2 Left 1046300962 8:112288432-112288454 CCAGGCAGTCACTTCATAGGGAT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1046300965 8:112288457-112288479 ATCACTAGTTAAAAGATTTGGGG No data
1046300962_1046300963 0 Left 1046300962 8:112288432-112288454 CCAGGCAGTCACTTCATAGGGAT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1046300963 8:112288455-112288477 TAATCACTAGTTAAAAGATTTGG No data
1046300962_1046300964 1 Left 1046300962 8:112288432-112288454 CCAGGCAGTCACTTCATAGGGAT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1046300964 8:112288456-112288478 AATCACTAGTTAAAAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046300962 Original CRISPR ATCCCTATGAAGTGACTGCC TGG (reversed) Intronic
902747945 1:18485591-18485613 ATCTATAGGTAGTGACTGCCTGG - Exonic
905502070 1:38447340-38447362 ATGCCTATGAAAAGACTGCTTGG + Intergenic
906830110 1:49021966-49021988 ATCCCTGTGAAATGGCAGCCTGG + Intronic
908784772 1:67724022-67724044 ATTCCTCTGTAGTCACTGCCTGG - Intronic
912391005 1:109302840-109302862 ATCTCTGAGAAGTGGCTGCCCGG + Intronic
917270631 1:173269589-173269611 ATGGCTATGAAGTGACTAACAGG + Intergenic
921261513 1:213388743-213388765 GTCCCTGGGAAGTGACTCCCAGG - Intergenic
921525824 1:216216599-216216621 ATCCCTAAGAAATGCCTGCTGGG - Intronic
922117270 1:222626287-222626309 CTCCTGATGAAGAGACTGCCCGG + Intronic
922209194 1:223474508-223474530 TTCCTAATGAAGAGACTGCCAGG + Intergenic
1062813511 10:482782-482804 ATCTCTCTGAAGAGGCTGCCAGG + Intronic
1068289462 10:54984080-54984102 ATTCCTATGAAGGGACTGTCAGG + Intronic
1068518020 10:58047955-58047977 ATCCCTATGAAGCTACTGAGGGG - Intergenic
1070274815 10:74995640-74995662 ATCTCTATGAAGTCATTTCCAGG - Intronic
1070336688 10:75461874-75461896 AGCCCTATGAGGTGGCGGCCAGG + Intronic
1071833360 10:89393946-89393968 ATTCGTATTAAGTGACAGCCTGG + Intronic
1084422967 11:69069803-69069825 AGTCCTAGGAAGTGACTGCAGGG + Intronic
1088351052 11:108888103-108888125 TTGTCTATGAAGTGACTGGCAGG - Intronic
1090594590 11:128307609-128307631 ATCCCTTTTAAGTGAAGGCCAGG + Intergenic
1091986651 12:4915097-4915119 CAACCTGTGAAGTGACTGCCAGG - Exonic
1099644881 12:85340289-85340311 ATGCATATGAATTGAATGCCTGG + Intergenic
1111274559 13:85931803-85931825 ACCCATATGAAGTTACAGCCAGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1120887304 14:89461873-89461895 ATCCCTAAGAATTGGATGCCTGG - Intronic
1130801995 15:87274372-87274394 CCCCCTCTGAAGTGACTTCCAGG + Intergenic
1137260404 16:46823176-46823198 AGTCCTATGAAGTGACTGGAAGG - Intronic
1137985208 16:53101511-53101533 AAACTTATGAAGTTACTGCCTGG + Intronic
1139611301 16:68060956-68060978 GTCCCTTGGAAGTGAGTGCCGGG + Intronic
1146682996 17:34822101-34822123 ATCCCTCTGCATGGACTGCCAGG + Intergenic
1153446783 18:5181720-5181742 ATCCCTAGCTAGTGACTGCATGG + Intronic
1154356953 18:13628659-13628681 ATCCTTATGCAGTTTCTGCCGGG - Intronic
1156029492 18:32695714-32695736 ATCCCTATGCAGTGACTCGGTGG + Intronic
1158131694 18:54159227-54159249 ATCCCTTGCAAGTGACTGCAGGG + Intronic
1162614223 19:11784289-11784311 CTCCATCTGAAGTGACTTCCAGG - Intergenic
1164381196 19:27738339-27738361 GTCCCTATCAATAGACTGCCTGG + Intergenic
931677505 2:64712428-64712450 CTCCATATGAAGTGATTGCTAGG + Intronic
931926032 2:67073555-67073577 ATCCCCATGACTGGACTGCCAGG + Intergenic
935868946 2:107424094-107424116 TTCCCTATGAAGAGATTGCTAGG - Intergenic
936949702 2:117965634-117965656 ATGCCTATAAAGTGGCTGCCGGG - Intronic
937980894 2:127614743-127614765 ATCCCCATGAAGTCCCTTCCAGG + Intronic
941873360 2:170408694-170408716 ATCCCTCTTAACTGGCTGCCAGG + Intronic
942988031 2:182164941-182164963 TTCCCTGTGAAGTGAATTCCTGG - Intronic
946894614 2:224310629-224310651 ATCCCTTTTCAGTGCCTGCCAGG + Intergenic
1168773023 20:428142-428164 ATCCCTAACAAGGGCCTGCCCGG - Intronic
1169399102 20:5264746-5264768 ATCCTTAAGAATTGACTTCCAGG - Intergenic
956972236 3:74539614-74539636 ATATCTATGTAGGGACTGCCTGG - Intergenic
960835053 3:121897234-121897256 ATGACTGAGAAGTGACTGCCAGG - Intronic
962100147 3:132333398-132333420 ATGCCTATGATGGGACTGCAGGG - Intronic
967015435 3:185477489-185477511 TTCCCTATAAGGTGGCTGCCAGG - Intronic
969030892 4:4212814-4212836 ATTCCTATGAAGTGTATCCCAGG - Intronic
979724041 4:123939177-123939199 ATCCCTATCTAGTGCCTCCCTGG + Intergenic
980692912 4:136319584-136319606 ATGCCTATGTAGTGGCTGCACGG + Intergenic
985944170 5:3163800-3163822 GTCCCTGTGAAGCGAGTGCCTGG + Intergenic
989977462 5:50603073-50603095 AACCCTAGGGAGTGGCTGCCTGG - Intergenic
990793778 5:59516284-59516306 ATCCAGAGAAAGTGACTGCCTGG - Intronic
992846566 5:80755235-80755257 ATCCCTATGCACTGACAGTCGGG - Intronic
998944411 5:147322175-147322197 ATCTCGATGCAGTGACTGGCTGG - Intronic
1001654469 5:173338947-173338969 ATGGCTATGCAGTGCCTGCCAGG - Intergenic
1001806851 5:174594018-174594040 CTCCCGATGAAGGGCCTGCCAGG - Intergenic
1004490885 6:16114517-16114539 ATATCTATGCAGTGACTGCATGG - Intergenic
1005470769 6:26160162-26160184 ATCCCTATGGTATGAATGCCAGG - Intronic
1008904743 6:56663911-56663933 AAACCTATGAAAAGACTGCCAGG + Intronic
1029293496 7:99520245-99520267 ATCCCTATAAAGGGACTTCTGGG - Exonic
1032414013 7:131722386-131722408 ATCCCTGTGAAGTGACTCTGGGG + Intergenic
1032831616 7:135632889-135632911 ATCCTTTTTAATTGACTGCCTGG + Intronic
1033176834 7:139132523-139132545 CTCCCTGGGATGTGACTGCCAGG + Intergenic
1033720177 7:144050830-144050852 ATGCCCAAGAAGTGACAGCCAGG - Exonic
1034702612 7:153109402-153109424 AACCTTTTGAAGTCACTGCCAGG - Intergenic
1041610396 8:59839887-59839909 ATCCAGATGTAGTGACTGACTGG + Intergenic
1043469766 8:80550743-80550765 ATACCTATGAAGCATCTGCCAGG + Intergenic
1045263885 8:100602704-100602726 ATCACTACTAAGTGACTGACGGG + Intronic
1046300962 8:112288432-112288454 ATCCCTATGAAGTGACTGCCTGG - Intronic
1056269909 9:84937222-84937244 ACCTCTATGGAGTGACTGCCGGG + Intronic
1058027185 9:100154645-100154667 ATAACTATGAAGTGACCTCCAGG + Intronic
1059815498 9:117908393-117908415 ATCCAGCTGAAGTGACTTCCTGG + Intergenic
1062078619 9:134606468-134606490 ATCACTGTGAACTGACTGTCGGG - Intergenic
1186957329 X:14697727-14697749 GACCCTATGAAGTGATAGCCCGG - Intronic
1195618768 X:106933081-106933103 ATCCATATGAAATGAGGGCCTGG + Intronic
1195687971 X:107602597-107602619 ATCCCCATGAAGATCCTGCCTGG + Exonic
1202265480 Y:23013374-23013396 ATCCTTATGATGTGACTCTCCGG + Intergenic
1202418473 Y:24647116-24647138 ATCCTTATGATGTGACTCTCCGG + Intergenic
1202452313 Y:25022970-25022992 ATCCTTATGATGTGACTCTCCGG - Intergenic