ID: 1046304219

View in Genome Browser
Species Human (GRCh38)
Location 8:112341548-112341570
Sequence GTGGTGCTGAATAAGGAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046304213_1046304219 28 Left 1046304213 8:112341497-112341519 CCTTGTTTGTTTTGTGAATAGTC 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1046304219 8:112341548-112341570 GTGGTGCTGAATAAGGAAGATGG 0: 1
1: 0
2: 1
3: 15
4: 245
1046304212_1046304219 29 Left 1046304212 8:112341496-112341518 CCCTTGTTTGTTTTGTGAATAGT 0: 1
1: 0
2: 2
3: 42
4: 429
Right 1046304219 8:112341548-112341570 GTGGTGCTGAATAAGGAAGATGG 0: 1
1: 0
2: 1
3: 15
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046304219 Original CRISPR GTGGTGCTGAATAAGGAAGA TGG Exonic
900309425 1:2026271-2026293 GTGATGCTGAGTAACGAAGCCGG - Intronic
901713013 1:11130497-11130519 TTGGTTGTTAATAAGGAAGAAGG + Intronic
901871333 1:12140770-12140792 GGGGTGCTGGATTAGGGAGAAGG - Intronic
901955482 1:12782022-12782044 GTGGGGCTGTATAAGGAGGCTGG + Intergenic
901978849 1:13018072-13018094 GTGGGGCTGTATAAGGAGGCTGG + Intronic
902003232 1:13210866-13210888 GTGGGGCTGTATAAGGAGGCTGG - Intergenic
902022457 1:13356616-13356638 GTGGGGCTGTATAAGGAGGCTGG - Intergenic
902355837 1:15899273-15899295 GGGGTGCTGAGTCAGGAAGATGG - Intronic
904273021 1:29362785-29362807 GTGGAGCAGAACAAGGATGAGGG - Intergenic
904419528 1:30382705-30382727 GAGGTGCTGACTGAGGAATAAGG - Intergenic
904621364 1:31777258-31777280 GTGGTCCTGAACAAGGATGGTGG - Intergenic
906078570 1:43069120-43069142 GTGGGGCTGAAGGAGGGAGATGG + Intergenic
906132209 1:43467311-43467333 GAGGTGCTGGATGAGGAAAAAGG - Intergenic
907870007 1:58434499-58434521 ATGGAGCTGATTTAGGAAGAAGG + Intronic
908787856 1:67753055-67753077 GTGGAGCTAAGTAGGGAAGAGGG - Intronic
908848058 1:68344973-68344995 GTGGAGATGAATGAGGTAGAGGG + Intergenic
909207355 1:72776354-72776376 GTAGTGCTGAAGAACAAAGAAGG + Intergenic
909562851 1:77024906-77024928 GAGGGGCTGACTAAGGAAGGTGG - Intronic
910479326 1:87641152-87641174 GTGGTGGTCAAGAAGGAAGGTGG + Intergenic
911058200 1:93725174-93725196 GTATTGCTGAATAAAGGAGACGG - Intronic
911117496 1:94260987-94261009 GGGGTGCAGAATTAGGAAGGTGG - Intronic
912248957 1:107991151-107991173 GTGGTGCTTATTCAGGAAAAGGG + Intergenic
916666138 1:166969264-166969286 GTGGTGCTGAATAAGGAGTAGGG - Intronic
916681168 1:167106406-167106428 GTGGTGCTGTGCAAGGAAGAAGG + Intronic
917793674 1:178516223-178516245 GGGGAAGTGAATAAGGAAGATGG - Intronic
919272748 1:195371096-195371118 GTGGTGATGAATATTGACGATGG + Intergenic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
923311664 1:232741439-232741461 GTGGTGCTGTGTACGGAATATGG + Intergenic
924094170 1:240534097-240534119 ATGGTGTTGAATAAGGAAGCAGG + Intronic
924947119 1:248854046-248854068 GTGGTGCTAGAGAAGGAAGTGGG + Exonic
1064084924 10:12338298-12338320 GTGTTTCTGAAAAAGGAGGAAGG - Intergenic
1064619425 10:17200537-17200559 TTGGTCCTAAATAAGGAAGCAGG + Intronic
1064864845 10:19867697-19867719 GTTGGTCTGAATATGGAAGAAGG - Intronic
1067544113 10:47179579-47179601 GTGGTGAAGATTAAGAAAGAAGG + Intergenic
1069309896 10:67021782-67021804 GTGATGCTGAATTAGGACAATGG + Intronic
1070940233 10:80338005-80338027 GCTGTGGTGAATAAGGCAGATGG - Intronic
1071458634 10:85870632-85870654 GTGGTGCTGTGGAAGGAAGGTGG + Intronic
1074134594 10:110615657-110615679 GTGGGGGTGAATATGGAAGATGG - Intergenic
1074618200 10:115092362-115092384 GTGCTGCTGAGGAAGGAAAACGG + Intergenic
1075100346 10:119502257-119502279 GAAGGGCTGAATAAGGCAGATGG - Intronic
1075912414 10:126136112-126136134 GTGGGGGTGAAGAAGGAAGGAGG + Intronic
1077813810 11:5665910-5665932 AGGGTGCTAAATAGGGAAGAGGG - Intronic
1078090822 11:8263337-8263359 ATGGTGCTGGACAAGGAGGACGG - Exonic
1081112965 11:39159652-39159674 GAGGTGTAGAATAAGGTAGAAGG - Intergenic
1084191016 11:67498775-67498797 GCTGTGCAGGATAAGGAAGAGGG + Exonic
1087243154 11:95803132-95803154 GTTGTGGGGAATGAGGAAGATGG + Intronic
1087300192 11:96424132-96424154 GTGGGGAGGAATATGGAAGAGGG - Intronic
1087705888 11:101491490-101491512 TTGGTGCTAAATAAGGATAAAGG - Intronic
1091555351 12:1569341-1569363 GTGGGGTTGAAGAGGGAAGAAGG - Intronic
1091862263 12:3796449-3796471 AGGGTGCTGAATAAAAAAGAGGG + Intronic
1092188772 12:6502087-6502109 CTGATGCTGCAGAAGGAAGAGGG + Intronic
1093767246 12:22979116-22979138 GTGGTGCTGACTAAGTAGAAGGG + Intergenic
1099284633 12:80702534-80702556 GAGGTGCAGAATTATGAAGAAGG + Intergenic
1101558425 12:105832503-105832525 GTCCTGCTGAACAAGGCAGAAGG - Intergenic
1102568471 12:113812622-113812644 GTGGGGCTTATTAAGGAAGCTGG + Intergenic
1102650995 12:114442338-114442360 GTGCTGCTGGAGGAGGAAGAGGG + Intergenic
1104480034 12:129099709-129099731 GTGGGACTGAACATGGAAGAAGG - Intronic
1105826202 13:24125718-24125740 GAGGTGAGGAATAAGGAGGAGGG + Intronic
1105840940 13:24253145-24253167 GTGGTACTGGAACAGGAAGAAGG + Intronic
1106323184 13:28661223-28661245 GGGGTGCTGAGGCAGGAAGATGG + Intronic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109993556 13:70091132-70091154 GTAGAGATGAATAAGGGAGAAGG - Intronic
1111113499 13:83746553-83746575 GTTGTGCTGTATAAAGAAAATGG + Intergenic
1111450632 13:88410267-88410289 GTGGGCCTGAGAAAGGAAGAAGG - Intergenic
1112423814 13:99277853-99277875 GTGGTGGTAAATGAGCAAGAGGG + Intronic
1113986841 13:114324442-114324464 GTGGTTCTGGAGAAGGAACAGGG - Exonic
1114460460 14:22883214-22883236 GTGCTGCTGAGTGAGGGAGAGGG + Exonic
1116469889 14:45274913-45274935 GTGGTACTAAATAAGAATGAAGG - Intergenic
1116540018 14:46090380-46090402 GTATTGCTGAGTAATGAAGAGGG + Intergenic
1116820316 14:49620974-49620996 GTGGTGCTGAATGGAGAGGACGG + Exonic
1116951076 14:50879076-50879098 GTGGTATGGAATAAGGCAGAAGG - Intronic
1119910339 14:78344223-78344245 CTGGTGCTGAACCATGAAGAGGG - Intronic
1120899888 14:89566789-89566811 GAGGTGGAGAAGAAGGAAGATGG - Intronic
1121685973 14:95835452-95835474 GTGGAGCTGATTAAGTCAGAAGG - Intergenic
1122680702 14:103459933-103459955 CTGGTGATGAATATGGAAAAGGG - Intronic
1123001608 14:105298357-105298379 GTGATGCTGACAAAGGAAAACGG + Intronic
1123004234 14:105314012-105314034 GCGGCGCTGAATAAGGATGCTGG + Exonic
1123105197 14:105838029-105838051 GGGGTGCTGACTAAGGAGGGTGG + Intergenic
1124689258 15:31808257-31808279 GTGCTGCTCAAGTAGGAAGATGG - Intronic
1125296795 15:38211998-38212020 GTGGAGCTGATTGAGGAAGTTGG + Intergenic
1125720420 15:41842569-41842591 GTGGAGCTGAAAAAAGAAGCAGG + Exonic
1127808218 15:62540570-62540592 GTGGTGGTGAAGAAGGCAGGAGG + Intronic
1128770284 15:70276894-70276916 GTGCTGGGGATTAAGGAAGAGGG + Intergenic
1129317371 15:74753167-74753189 GTTGTGCTGAGGAGGGAAGAGGG - Exonic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129800171 15:78407821-78407843 GTGGTGCTGAGAAATGAGGAAGG - Intergenic
1129874692 15:78965990-78966012 TTGGTGTTGAATAAGGCAGAGGG + Intronic
1130568053 15:85015111-85015133 GTGCTGCTAAAAAAGGAAGGAGG - Intronic
1130772971 15:86943659-86943681 GTGATGAAGAAAAAGGAAGAGGG + Intronic
1131094732 15:89648188-89648210 GTGGTGGAGAGGAAGGAAGAGGG - Intronic
1131875619 15:96803053-96803075 GGATTGCTGAATATGGAAGACGG + Intergenic
1133535068 16:6693836-6693858 GAATTGCTGAATAAGGATGATGG - Intronic
1134423751 16:14118446-14118468 GTGGTTCTGCAGAAAGAAGATGG - Intronic
1139570684 16:67810001-67810023 ATGCTGGTGAATAAGGAATATGG - Intronic
1140872903 16:79123107-79123129 TGCGTGCTGTATAAGGAAGAAGG + Intronic
1141204121 16:81920131-81920153 GTAGAGCTAAATAAGGATGAGGG + Intronic
1141369463 16:83473738-83473760 GTGGAGCTGAGTAGGGAAGTTGG + Intronic
1144858085 17:18281770-18281792 TTGCTGCTGAATAAGAAAGGAGG - Intronic
1149871576 17:60186751-60186773 GTGGTGTAGAATGAAGAAGACGG + Intronic
1150628620 17:66859880-66859902 GAGGTGGAGAAGAAGGAAGAAGG - Intronic
1151250352 17:72829380-72829402 GTGGGGCTGGAAAAGGGAGATGG + Intronic
1152068255 17:78123088-78123110 GTGGGGATGGATAAGGAAGCAGG - Intronic
1152845501 17:82597241-82597263 AAGATGCTGAATAAGGCAGAAGG - Intronic
1153501649 18:5755849-5755871 GTGGGGCTGAAACAGAAAGATGG - Intergenic
1156379657 18:36546565-36546587 CTGGTGCTGGATACGGAACAAGG - Intronic
1156665832 18:39405971-39405993 ATGGTTCTGAAGTAGGAAGATGG - Intergenic
1157268488 18:46249742-46249764 ATGGTACTGAGTAAGGAATATGG - Intronic
1157429850 18:47615637-47615659 GTATTGCTTAACAAGGAAGAGGG + Intergenic
1157835639 18:50899691-50899713 GTGGTGAGGAATTAGGAAAAAGG - Intronic
1158387186 18:57008222-57008244 GGGGAGCTGAATGAGGAAGTGGG - Intronic
1159742996 18:72196498-72196520 TTGGCCCTGAATAAGGAAAAGGG + Intergenic
1160978083 19:1803595-1803617 GTGGTGTTAAAGAAGGAAGCCGG + Intronic
1163277537 19:16294824-16294846 GTGATGCTGAACAATGAAAACGG + Intergenic
1165694214 19:37888335-37888357 GAGGAACTGAATCAGGAAGAGGG - Exonic
1166707983 19:44919148-44919170 GTGGGGAGGAATAAGGAAGGGGG - Intronic
1166710035 19:44930975-44930997 GTGGGGAGGAATAAGGAAGGGGG - Intergenic
926946219 2:18190236-18190258 TTGGAGCAGAATAAAGAAGATGG + Intronic
927403889 2:22746345-22746367 GTGTTGCTGATAAAGGAAAAAGG - Intergenic
928903166 2:36343402-36343424 ATGGTTCTGAATAAGGTAAATGG + Intergenic
929588134 2:43128679-43128701 GTGGAGAGGAATGAGGAAGAGGG + Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930236579 2:48894653-48894675 CAGGTGCTGAAGAAGTAAGAGGG - Intergenic
932734682 2:74246396-74246418 GTAGAGCTGAATGAGGAACAGGG - Intronic
933151032 2:78915551-78915573 CTGGTGCTGGCTAAGGAAGTAGG + Intergenic
934743266 2:96741154-96741176 GTGGTGCCGGATAAAGACGAAGG - Intergenic
936659674 2:114528819-114528841 TTGATGATGAATCAGGAAGAAGG - Intronic
938164457 2:129014593-129014615 CTGGAGCTGAATGAGGAAGCTGG - Intergenic
938317705 2:130341637-130341659 GGGGTTCTGCAGAAGGAAGAGGG + Intronic
939388179 2:141529710-141529732 GTGTTGCTGAATAATGATAAAGG - Intronic
940490025 2:154347751-154347773 GTTGTGCTGAACATGAAAGAAGG - Intronic
941158362 2:162005948-162005970 GTGGTTATGAAGAAGGAAAAGGG + Intronic
941818712 2:169824690-169824712 GCGGTGCTGAAAAAGGGAGAAGG - Exonic
942301268 2:174564756-174564778 TTGGTGCCCAAGAAGGAAGAAGG + Intronic
942479173 2:176364238-176364260 GTGGTCCTCAATTAGGCAGATGG - Intergenic
942934777 2:181541769-181541791 GTAGTGAGGAATGAGGAAGAAGG + Intronic
943504044 2:188731168-188731190 GTGGTTCAGAGGAAGGAAGAAGG - Intergenic
944037215 2:195309373-195309395 GAGGAGGGGAATAAGGAAGAGGG - Intergenic
944560945 2:200937164-200937186 GTGGTGATTAAGAAGGAAGAGGG + Intronic
945785784 2:214234781-214234803 GTGGTCATGAATAAGGAAAAGGG + Intronic
945915849 2:215703153-215703175 CTGATGTTGAATAAGGGAGAAGG + Intergenic
947824157 2:233092889-233092911 GTGGGGCTGAGGAATGAAGATGG - Intronic
1169260451 20:4134589-4134611 GAGGTGCTGGAAAAGGAAGCTGG + Intronic
1169339766 20:4787505-4787527 CTGGTGCTGAAGAAGTAAAAGGG + Intronic
1169571844 20:6914767-6914789 TTGTTGCTGGAGAAGGAAGAGGG + Intergenic
1170196636 20:13695544-13695566 ATGGTGCAGAATAAGAAAAAGGG - Intergenic
1170269380 20:14507110-14507132 GTGGGGGTGAAGAAGGAATAGGG + Intronic
1171332349 20:24351495-24351517 GAGAGGCTGAATAAGGAGGAGGG - Intergenic
1172389580 20:34558097-34558119 GTGATGGGGAATAAGGAAAAGGG - Intronic
1173374614 20:42472265-42472287 GTGGTGCAGACTGAGGAAGACGG - Exonic
1174607644 20:51772581-51772603 GTAGTGCTGTGTCAGGAAGAGGG - Intergenic
1174823657 20:53749302-53749324 ATGGTGATGATTAAGTAAGAAGG + Intergenic
1175373543 20:58509208-58509230 TTGGTGCTGAGTGAGGAAGCAGG + Intronic
1176961698 21:15166111-15166133 GTTGTGCTGAATAAGTTAGGAGG - Intergenic
1177855470 21:26395701-26395723 GTGGTGGGGATTAAGGATGAAGG + Intergenic
1180581715 22:16844935-16844957 GTGGTGCTGGTGAAGGAGGAGGG + Intergenic
1180642177 22:17307798-17307820 GGGGTGCAGCAGAAGGAAGAAGG + Intergenic
1183828440 22:40405727-40405749 GTGGTGCTGAAGTAGGAGGCGGG - Exonic
950163308 3:10775765-10775787 GTGTCGTTGATTAAGGAAGACGG + Intergenic
950671033 3:14525527-14525549 GTGGAGCTGATCAAGAAAGAAGG - Exonic
952996728 3:38890196-38890218 GTGGGGAGGATTAAGGAAGAAGG + Intronic
953534199 3:43765004-43765026 GTGGTGCTGCATCTGGAAGGGGG + Intergenic
954376446 3:50196359-50196381 TTGGTGCTGGATGAGGAAGGAGG - Exonic
954834695 3:53455602-53455624 GTGGAGCTGCATAATGAGGATGG - Intergenic
954877615 3:53812755-53812777 GTGGTGCTGCTTAAGAAATAAGG + Exonic
956393782 3:68803033-68803055 CAGGTACTGAATTAGGAAGAAGG - Intronic
957910418 3:86614077-86614099 TTGGTGCTGAGTAAAGCAGATGG - Intergenic
958049474 3:88326228-88326250 TTTGGGCTGAAAAAGGAAGATGG - Intergenic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
960170771 3:114458083-114458105 ATGGTGCTGAAAATGGATGAAGG + Intronic
960176957 3:114528967-114528989 GTGGTGCAGAATAGGGAAAGGGG - Intronic
961140889 3:124555064-124555086 GTGGGGCTAAAACAGGAAGATGG - Intronic
961428561 3:126864348-126864370 GTGGTGATGAAGGAGGAGGAGGG - Intronic
963040556 3:141066639-141066661 GTGGTGCTGGACATGGATGAGGG + Exonic
963534783 3:146513995-146514017 ATTGTGCTGAATATGAAAGAGGG + Intergenic
965376665 3:167932701-167932723 GTGGGGCTGAAGCAGGAGGATGG + Intergenic
966403926 3:179575528-179575550 CTGGTGCTTAATAAGGAGGGAGG - Intronic
966570902 3:181441779-181441801 CTGCTGCTGAATGAGGAGGAGGG + Intergenic
966857312 3:184203731-184203753 GATGTGCTGACTTAGGAAGACGG + Intronic
968144706 3:196288256-196288278 GTGGGTCAGAAAAAGGAAGAGGG - Intronic
968717317 4:2170003-2170025 GTGGTGCTGGAGAGGGAATAGGG + Intronic
969525486 4:7701971-7701993 GTGGGGCGGGATAAGGAAGGAGG - Intronic
970243250 4:14031372-14031394 GAGATTCTGAATAAGGAAAATGG + Intergenic
971253634 4:24994021-24994043 GGGGTCCTGAAAAAGGAAGCAGG - Intergenic
971255199 4:25008096-25008118 GTGGTGCTACAGAAGGAAGGGGG - Intronic
971939304 4:33193579-33193601 GTGGTGATGATGAAGGCAGAAGG + Intergenic
972696618 4:41452688-41452710 GCGGTGCAGAAGAAGGAAGGAGG - Intronic
973258839 4:48140463-48140485 GTGGTGCTGAATGATGATGCAGG - Intronic
973876089 4:55220600-55220622 GTGGTGATGAATAATGGTGACGG - Intergenic
978017014 4:103756938-103756960 ATGGTGCTGAAAGTGGAAGAAGG - Intergenic
978573647 4:110166759-110166781 GGGTTGATGAAAAAGGAAGACGG - Intronic
981582573 4:146264853-146264875 GAGGAGCTGAATTAGGAAGATGG - Intronic
984632402 4:182074826-182074848 GTGGTGCTTAAAAATGAAGGAGG + Intergenic
985165819 4:187092880-187092902 GTGGTGCCCTATTAGGAAGAAGG + Intergenic
986095185 5:4547609-4547631 GAGGTGCGGAATAGGGTAGAGGG + Intergenic
988078156 5:26380360-26380382 GGGGTGCAAAATAATGAAGAAGG + Intergenic
989034400 5:37154900-37154922 GAGCTGCGGAACAAGGAAGAGGG - Intronic
989989287 5:50742159-50742181 GTGGTTCCGAATAAGGGAGGGGG + Intronic
991488680 5:67163785-67163807 GTGGTGGTGAAGAAAGCAGACGG + Exonic
993032394 5:82720476-82720498 GTGGTGCAGAATGAGGAATGTGG + Intergenic
993127597 5:83854758-83854780 GTGATGCTGGAGAAAGAAGAGGG - Intergenic
994377618 5:99032957-99032979 GTGGAGCTGAACAGGGAAAATGG - Intergenic
994497491 5:100532399-100532421 GAAGTTCTGAGTAAGGAAGATGG - Intergenic
995639079 5:114232836-114232858 GTGGTGCTGATCATGGAAGCAGG + Intergenic
997291434 5:132738537-132738559 CTGGTGCAGAAGAAGCAAGAGGG - Intergenic
998031342 5:138871546-138871568 CTGCTGCTGAAAAGGGAAGAGGG - Exonic
998393622 5:141804137-141804159 CTCCTGCTGAATAAGGAAGAGGG - Intergenic
1000261411 5:159591988-159592010 GTGGTGCTGAACAAAGATCAGGG - Intergenic
1000444866 5:161307119-161307141 GTGGTGAGGAAGGAGGAAGAAGG - Intronic
1001175029 5:169460464-169460486 GTGGTGCTGAAGATGCAAGGTGG + Intergenic
1001491108 5:172156020-172156042 GTGTTGCTGAGTTTGGAAGATGG + Intronic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1006236736 6:32639884-32639906 GTCATGCTGGATAGGGAAGAAGG + Intronic
1007260840 6:40561949-40561971 GTGGGGCTGAATAAGACTGATGG - Intronic
1007998957 6:46338624-46338646 GTGGTACTGAATAAGAAGGTGGG - Intronic
1011792993 6:90918068-90918090 GTTATACTCAATAAGGAAGATGG - Intergenic
1012815722 6:104019360-104019382 CTGCTGCTGAACAAGGGAGAAGG + Intergenic
1013044532 6:106471123-106471145 GTGGAGCTCAATGAGGAGGATGG + Intergenic
1013945132 6:115713960-115713982 GTTGTGCTGAATAAGTGAAAGGG + Intergenic
1015892223 6:137980303-137980325 GTTTTGCTGTAAAAGGAAGAAGG - Intergenic
1020027984 7:4912654-4912676 GTGGTGATGACTGAGGAAGAGGG + Intronic
1020208573 7:6139843-6139865 CTGGTCCTGAAGCAGGAAGATGG - Intronic
1020393074 7:7681497-7681519 GTGGTGCCGAATAAGAATAAGGG + Intronic
1022282050 7:28920774-28920796 GGGGTGCGGGATAAGGAAAAGGG - Intergenic
1024909433 7:54428332-54428354 GTATTGCTGAATAAGGTAGTAGG + Intergenic
1029155194 7:98512439-98512461 GTGGGGCTGAAAGAGGAAGGAGG + Intergenic
1029299921 7:99573367-99573389 GTGATGCTGAATAAGGCATGAGG - Exonic
1029386253 7:100245536-100245558 GGGGTGCTGAGCAAGGCAGAGGG - Intronic
1030300483 7:107969353-107969375 ATGGTGGTGAATAAAGAAAATGG + Intronic
1031885591 7:127242990-127243012 GGGGAGCTGAAGAAGGAAAAGGG - Exonic
1032423915 7:131805054-131805076 GTGATGCTGAAAAATGAACATGG + Intergenic
1033981903 7:147175567-147175589 ATAGTGTTGAAGAAGGAAGAGGG + Intronic
1035038731 7:155912091-155912113 GTGGTGCTGGAGCAGGAAGGGGG - Intergenic
1035737127 8:1897256-1897278 GCCGTGCTGGATAAGGCAGAGGG - Intronic
1040460604 8:47644178-47644200 GTGGTGTTTATCAAGGAAGAAGG + Intronic
1040589027 8:48772333-48772355 GGGGTGAAGAGTAAGGAAGATGG - Intergenic
1041207702 8:55514824-55514846 GTAGTACTGAACAAAGAAGAGGG + Intronic
1041846039 8:62330205-62330227 GGGGTGATGAATAATGAGGATGG + Intronic
1041862226 8:62527398-62527420 GTTGTCCTGACTAAGGAAGAAGG - Intronic
1042621759 8:70714073-70714095 GTGGGGATGAGTAAGGAGGAGGG + Intronic
1045102942 8:98863757-98863779 GGTGTGGTTAATAAGGAAGAAGG - Intronic
1045456915 8:102389703-102389725 GTAGTGCAGTAAAAGGAAGATGG - Intronic
1045883749 8:107071463-107071485 ATGGTGTTGACCAAGGAAGAGGG + Intergenic
1046304219 8:112341548-112341570 GTGGTGCTGAATAAGGAAGATGG + Exonic
1046477022 8:114758910-114758932 GAGGTGGTGAATTAAGAAGAAGG - Intergenic
1049040106 8:140106175-140106197 CAGGTGCTGAATGAGGAAGCAGG - Intronic
1051041378 9:12816470-12816492 GTGGTGTTGTATGAGGAACATGG - Intronic
1051807241 9:21008614-21008636 CTGGTGGTTAAGAAGGAAGAAGG - Intronic
1058794656 9:108486323-108486345 GAGGTGAAGAATAAGGAAGAAGG + Intergenic
1059031343 9:110700728-110700750 GTGGTGCTGGATAATGCACAAGG + Intronic
1188838690 X:34989077-34989099 GTGGTGGCGAACAGGGAAGAAGG - Intergenic
1189310568 X:40014698-40014720 GGGGTGCTCAGGAAGGAAGATGG - Intergenic
1190481889 X:50885408-50885430 GAAGTGCTAAAAAAGGAAGAGGG - Intergenic
1191604273 X:63044253-63044275 GTGGGGCCAAATAAGGGAGAAGG - Intergenic
1192131543 X:68556613-68556635 GTGGCTCAGAACAAGGAAGAAGG - Intergenic
1193075925 X:77355551-77355573 GTGGTTTTGAATAGGGAAGAGGG + Intergenic
1195816828 X:108897040-108897062 GTGGTGCTGAATAAGGCCATGGG + Intergenic
1196377015 X:115044594-115044616 ATGGTGCAGAGAAAGGAAGATGG + Intergenic
1196975382 X:121152956-121152978 GAGGTGGCAAATAAGGAAGAAGG + Intergenic
1197345966 X:125326172-125326194 GTGGTGATGGATGAGGAACATGG + Intergenic
1198388332 X:136148327-136148349 GGGGTGCAGAATAAGGAGGGAGG + Intronic
1199122211 X:144068984-144069006 GAGATGCTGAACAAGGGAGAGGG - Intergenic
1200056053 X:153461779-153461801 CTGCTGCTGGAAAAGGAAGATGG + Intronic