ID: 1046314710

View in Genome Browser
Species Human (GRCh38)
Location 8:112483979-112484001
Sequence CACCTTGACCTTCAACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046314710_1046314716 27 Left 1046314710 8:112483979-112484001 CCTGGCTGTTGAAGGTCAAGGTG 0: 1
1: 0
2: 2
3: 11
4: 173
Right 1046314716 8:112484029-112484051 CTTTATCTTCTAGAAGCCTGGGG No data
1046314710_1046314714 25 Left 1046314710 8:112483979-112484001 CCTGGCTGTTGAAGGTCAAGGTG 0: 1
1: 0
2: 2
3: 11
4: 173
Right 1046314714 8:112484027-112484049 CTCTTTATCTTCTAGAAGCCTGG No data
1046314710_1046314715 26 Left 1046314710 8:112483979-112484001 CCTGGCTGTTGAAGGTCAAGGTG 0: 1
1: 0
2: 2
3: 11
4: 173
Right 1046314715 8:112484028-112484050 TCTTTATCTTCTAGAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046314710 Original CRISPR CACCTTGACCTTCAACAGCC AGG (reversed) Intronic
900300762 1:1975992-1976014 CACCTTGACCTTGGACTTCCCGG - Intronic
902688585 1:18095375-18095397 CTTCTTGATCTTCCACAGCCTGG + Intergenic
902859197 1:19232621-19232643 CACCTTGTCCTTCACCAGCAGGG + Exonic
903162039 1:21496001-21496023 AACCTTGACCCTCAAGACCCAGG + Intergenic
904938305 1:34147439-34147461 CTCCTAGACCTTCCACAGTCTGG - Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
905765200 1:40594862-40594884 CTCCTTGGCCTTCCAAAGCCTGG - Intergenic
907982025 1:59492530-59492552 CCCCTTGAACTCCAGCAGCCAGG - Intronic
909583494 1:77263616-77263638 CACCTCCACCATCAACAGCCTGG + Intergenic
909613225 1:77575408-77575430 CACGTTTACTTTCATCAGCCTGG - Intronic
909677139 1:78251268-78251290 CACCTTGATCTTGAAAAGCCTGG + Intergenic
910763531 1:90758488-90758510 AACCCTGACCTACAACAGACAGG - Intergenic
911812900 1:102307035-102307057 CACCTTGATCTTGAACATCCAGG - Intergenic
912614586 1:111085462-111085484 CCCCTTGCCCTTCACCAGGCAGG - Intergenic
912725631 1:112056949-112056971 TACCTTGACCTGCAACTTCCTGG + Intergenic
912916043 1:113815925-113815947 CACCTTGGCCTTCCAAAGTCTGG + Intronic
913339026 1:117738745-117738767 CACCTTGACCTTCGACTTCCAGG - Intergenic
916194430 1:162210276-162210298 CAGCTCGACCTTCAAGAGCACGG + Intronic
917820676 1:178760730-178760752 AGCATTGACCTTCAACAGTCTGG + Intronic
918613808 1:186521818-186521840 CATCTTGTCCTGCAAAAGCCAGG - Intergenic
920198479 1:204244962-204244984 CACCTACAGCTCCAACAGCCCGG - Exonic
920312981 1:205059280-205059302 AAGCCTGACCTTCAGCAGCCAGG - Exonic
921968673 1:221120622-221120644 CACCTTGATCTTGAACTTCCCGG - Intergenic
922078111 1:222268041-222268063 AGCATTGAACTTCAACAGCCTGG - Intergenic
923086918 1:230709151-230709173 CCCATTGACCTTTAAAAGCCTGG + Intronic
1063208124 10:3854282-3854304 CGCCTTATCCTTCACCAGCCCGG + Intergenic
1064327798 10:14366844-14366866 CACTTTGTCCTCCAGCAGCCTGG - Intronic
1068390696 10:56392447-56392469 CACCTTGATCTTGGACATCCAGG + Intergenic
1069884852 10:71617249-71617271 CACCACGACCTTCAATATCCTGG + Intronic
1070120385 10:73570658-73570680 CACCTTGACCTCCCAAAGGCTGG + Intronic
1070304827 10:75234072-75234094 CACCTTGGCCTTCAAGATCTAGG - Exonic
1071240709 10:83701657-83701679 TAGCATGACATTCAACAGCCTGG - Intergenic
1071491752 10:86140989-86141011 CCCCTTGTCCATCAGCAGCCTGG + Intronic
1071563778 10:86661413-86661435 CACCTTGGCCTCCAAGGGCCTGG + Intronic
1072196400 10:93120314-93120336 GCCCTTGTCCTTCTACAGCCAGG - Intergenic
1075094002 10:119459258-119459280 CACGCTGAGCTTCAACAGCTGGG - Intronic
1075275616 10:121090007-121090029 CACCTCAACCTCCACCAGCCAGG + Intergenic
1076424092 10:130355129-130355151 CATCTACACCTTCACCAGCCAGG + Intergenic
1076738620 10:132469595-132469617 GGCCTTGACTTTCACCAGCCTGG + Intergenic
1077400087 11:2351004-2351026 CACCTTGATCTTGAACTTCCCGG - Intergenic
1078272373 11:9808050-9808072 CAGCTTGACCCTCAACTGTCAGG - Exonic
1081541477 11:44037617-44037639 AAACTTCACCTTCCACAGCCTGG - Intergenic
1087106617 11:94415884-94415906 CACCGTGACCTCCAACTCCCAGG + Exonic
1087924212 11:103900595-103900617 CACCTTGTCCTTCCTCAGCTGGG - Intergenic
1091267569 11:134282682-134282704 CACCCTGACCCTCAGCAGTCTGG - Intronic
1091336744 11:134775466-134775488 CACCTTAATCTTCAACATCTAGG - Intergenic
1092109624 12:5949831-5949853 CACCTTGACATACTGCAGCCTGG + Exonic
1096087767 12:48877555-48877577 ATCCTTGGCCTTCAGCAGCCTGG - Intergenic
1099741918 12:86648646-86648668 CACCTTGATCTTGAACGTCCCGG + Intronic
1101395319 12:104342055-104342077 CACCTTGATATTCACCAACCTGG + Intronic
1101818116 12:108161592-108161614 CACCTTGACCTCTGACTGCCAGG + Intronic
1102780788 12:115562748-115562770 CATCATGACCTTGAGCAGCCTGG - Intergenic
1102945038 12:116979436-116979458 CACCTTGACAAGCAGCAGCCAGG - Intronic
1103144239 12:118580636-118580658 CACCTTGATCTCCAACTTCCAGG + Intergenic
1103478570 12:121236136-121236158 CACCTTGATCTTGAACTTCCTGG + Intergenic
1106467815 13:30028452-30028474 CACCTTGGCCTTCCACAAACTGG - Intergenic
1111150358 13:84245580-84245602 CAACTGGACTTCCAACAGCCGGG - Intergenic
1111327183 13:86714344-86714366 CACCTTTGCTTTCAGCAGCCTGG - Intergenic
1113729797 13:112633043-112633065 CACCTTGACCTTGGACTTCCAGG - Intergenic
1113831070 13:113296606-113296628 CACCTTCACCTTGGGCAGCCTGG + Intergenic
1116304472 14:43232894-43232916 CACCTTGACCTTCCAGAGCTGGG - Intergenic
1117097741 14:52314890-52314912 CGCCATGACCTTCTTCAGCCTGG + Exonic
1118898093 14:69963699-69963721 CACCTTGACCTCCCACAGGAAGG - Intronic
1121373386 14:93381877-93381899 CACCTTGACTCTTATCAGCCTGG + Intronic
1123018162 14:105385303-105385325 CACCTGTTCCTTCCACAGCCTGG + Intronic
1123695045 15:22873086-22873108 CACAGTCACCTTCCACAGCCAGG + Intronic
1123986390 15:25650129-25650151 CACCTTGATCTTGAACTTCCAGG - Intergenic
1124212446 15:27774879-27774901 CACCTTGACCTTGGACTTCCAGG + Intronic
1127075300 15:55319367-55319389 TACCTTGTACTTCAACACCCAGG + Exonic
1127457089 15:59165071-59165093 CACCTTGACCTTGGACTTCCCGG + Intronic
1128321376 15:66697074-66697096 CACCTTTACCTTCAATACACTGG + Intergenic
1129368715 15:75073789-75073811 CACCTTGACCTTCCAAAGTGCGG + Intronic
1129776675 15:78241404-78241426 CACCTTGGCCTTCCAAAGTCGGG - Intronic
1134646587 16:15872631-15872653 CACCGTAACCTTGAACTGCCGGG - Intronic
1136466704 16:30449216-30449238 CACCTTGAACTTGAACTCCCAGG - Intergenic
1136996005 16:35188411-35188433 CTCCTTGCCCTTCTTCAGCCAGG - Intergenic
1139587699 16:67914831-67914853 CAGCTGGACCCTCAACAGCCTGG - Intronic
1139701802 16:68712283-68712305 CACCTTGACCTCCTAAATCCTGG + Intronic
1141324005 16:83038515-83038537 CATCATGACCTTCCACAGACAGG - Intronic
1142134729 16:88446413-88446435 CCCCATGACCTTCACCAGGCAGG - Intergenic
1143610222 17:8013792-8013814 CATCTTGGTCTTCAACAGTCAGG + Intronic
1144599783 17:16601443-16601465 CACCTTGACCTTGACCACCAGGG - Intergenic
1147218243 17:38913151-38913173 CACCTTGACCACCACCACCCAGG - Intronic
1148835933 17:50465768-50465790 CAACTTCCCCTTCGACAGCCTGG - Exonic
1149471962 17:56924322-56924344 CACTTTGTCCTCCAGCAGCCTGG - Intergenic
1150583218 17:66494349-66494371 CACCTTGATCTTCGACTTCCTGG - Intronic
1157244362 18:46040450-46040472 CATGTTGACCTTCGACAGACTGG + Intronic
1157797576 18:50589131-50589153 GACCTAGACTGTCAACAGCCAGG - Intronic
1158443470 18:57498576-57498598 CATCTTCACCTTCACCACCCTGG + Intergenic
1161989692 19:7677665-7677687 CACCTTGGCCTTCAAAAATCAGG + Exonic
1162519763 19:11172948-11172970 CACCTGGATCTGCAGCAGCCGGG + Intronic
1162844741 19:13383548-13383570 CACCTTGTCCCACAACACCCTGG + Intronic
1167135526 19:47613152-47613174 CCCCTGGCCCTTCCACAGCCTGG - Intronic
1167262295 19:48465938-48465960 CACCTTCACCTTCACCTTCCAGG - Exonic
1168379075 19:55905108-55905130 CACCTGCACCTTCCACAGCCTGG - Exonic
925710269 2:6732229-6732251 CACCTTGATCTTGAACTTCCTGG + Intergenic
927460539 2:23294672-23294694 TACATTAACTTTCAACAGCCAGG + Intergenic
929423047 2:41814918-41814940 CACTTTCACCTTGGACAGCCAGG - Intergenic
931573582 2:63696557-63696579 GACCTTCACCTCCACCAGCCTGG + Intronic
932415355 2:71570315-71570337 CACCTTGCTCATCGACAGCCCGG - Exonic
934152379 2:89159801-89159823 CACCCTCACCATCAATAGCCTGG - Intergenic
934214868 2:90022113-90022135 CACCCTCACCATCAATAGCCTGG + Intergenic
934219622 2:90070166-90070188 CACCTTTACCATCAGTAGCCTGG + Intergenic
936022463 2:109005358-109005380 CAAGTAGACCTTCCACAGCCTGG + Intergenic
937401055 2:121584064-121584086 CACCTTGACCTTAGACTTCCAGG + Intronic
938017522 2:127879778-127879800 CACCTGGTCCTCCAGCAGCCCGG + Intronic
942075858 2:172356702-172356724 CACCATGACCTCCAACATTCGGG - Intergenic
944547745 2:200814318-200814340 TACCCTAACCATCAACAGCCAGG - Intronic
944975314 2:205043226-205043248 TAACTTGACTTTCAAGAGCCTGG + Intronic
945645394 2:212485744-212485766 TACCTTGACCTTGAACTTCCCGG - Intronic
948024963 2:234769464-234769486 CACCTTGGCCTTGAAAAGCGCGG - Intergenic
948766869 2:240226940-240226962 CACCTTGCCCCTCAGCAGGCAGG + Intergenic
948828388 2:240585500-240585522 CAGTTTCTCCTTCAACAGCCGGG + Intergenic
1169748732 20:8969611-8969633 CACCCTGAAATTCAACAACCTGG + Intergenic
1173065062 20:39702897-39702919 CACATTAACCTTCAGCAGCATGG + Intergenic
1174173482 20:48630952-48630974 CACCTGTTCCTACAACAGCCGGG + Intronic
1174600506 20:51720583-51720605 CACCTTGACCTCCCAAAGCTGGG - Intronic
1175013880 20:55767471-55767493 CACAGTGACCTTCAGCATCCCGG - Intergenic
1178685879 21:34710319-34710341 AACATTGACCCTCAACATCCAGG + Intronic
1178938270 21:36882917-36882939 CTCCTTGCCCTTCCACAACCAGG + Intronic
1179330221 21:40393237-40393259 CACCTTCCCCTTCATCATCCAGG + Intronic
1183018132 22:35006663-35006685 CACCCTGACCCTAGACAGCCTGG + Intergenic
1183227694 22:36561695-36561717 CACCTTGACCTTCAGTCACCTGG + Intergenic
1183296777 22:37034360-37034382 CACCCTGACCTCCAACTCCCTGG + Intergenic
1183806121 22:40212610-40212632 CCTCTTGCCCTTCAACAGCTGGG + Intronic
951870650 3:27357899-27357921 CACCTTGAGCTTTAACTGCTTGG - Intronic
954668953 3:52277906-52277928 GACCTTGACCTTTAAACGCCCGG - Intronic
955025679 3:55165146-55165168 CACCTGGCCCTTCCTCAGCCTGG - Intergenic
967418767 3:189250847-189250869 CTGTTTGACCTTCAACACCCAGG + Intronic
968811244 4:2800558-2800580 CACCTGGCCCGTCATCAGCCCGG - Intronic
969462398 4:7335722-7335744 CTCCTTGAGCTTCAACCTCCTGG - Intronic
973001703 4:44960136-44960158 AACATTGACCTTAAACAGTCTGG + Intergenic
973966269 4:56165145-56165167 CATCTTTACCTCCAACTGCCTGG + Intergenic
975721270 4:77250867-77250889 CACCTTGACCTACAACAGCATGG - Intronic
975721603 4:77253890-77253912 GAACTTGACCTGCAACAGCATGG - Intronic
975724496 4:77278851-77278873 CACCTTGACCTACAACAGCATGG - Intronic
978546184 4:109874865-109874887 CACCTTCACCGTTAACACCCAGG + Intergenic
981923848 4:150116782-150116804 CACCATGGCCTTCATCACCCTGG - Intronic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985811687 5:2094781-2094803 CACCTTGTCCTTTCCCAGCCAGG - Intergenic
985913793 5:2902739-2902761 CACATTGACCATAAAGAGCCAGG + Intergenic
988408068 5:30849987-30850009 TACCTTGACCTCAAACAGCATGG + Intergenic
989315148 5:40069814-40069836 CACTGTCACCTTCAACAGCAAGG + Intergenic
989995786 5:50828807-50828829 CACCTTCACCTTCACCTCCCGGG - Intronic
992466849 5:77014615-77014637 CACCCTGACTTTCAAAAACCAGG - Intergenic
996394106 5:122995328-122995350 CCCCTTGACTTTCCACTGCCTGG + Intronic
997212304 5:132084320-132084342 CACCTTAGCCTTGAACTGCCGGG - Intergenic
999182743 5:149681372-149681394 CTCCATGACCTTCTACAGCTAGG + Intergenic
1005467524 6:26130022-26130044 CACCTTGATCTTAAACTTCCAGG - Intronic
1011072726 6:83403357-83403379 CAGCTTGACCTTGAACTTCCTGG - Intronic
1011602747 6:89075159-89075181 CACCCTGATCTTGAACATCCCGG - Intergenic
1012978019 6:105800838-105800860 CACCTTGACCCTGAAGAGGCTGG - Intergenic
1014325177 6:119985267-119985289 CACCTTGATCTTGAACTTCCAGG - Intergenic
1014629876 6:123775093-123775115 CACATTGACCATTAACATCCTGG + Intergenic
1017304344 6:152899072-152899094 CACCTTCAACATCAACAGCGTGG + Intergenic
1017544921 6:155440183-155440205 CACCTTGACATTAAATATCCTGG + Intronic
1019184095 6:170210884-170210906 CATCTTCACCTTCACCAGCCTGG - Intergenic
1020218352 7:6213602-6213624 CTCCTTGGCCTTCAACCCCCAGG + Intronic
1021764997 7:23939837-23939859 AACCTTGACCTTGACCTGCCAGG - Intergenic
1023571043 7:41572167-41572189 CACCTTGATCTTAAACTTCCTGG + Intergenic
1024757506 7:52552868-52552890 CATGTTGCCCTTCAACAGCCAGG - Intergenic
1028151527 7:87379059-87379081 CTCCTTGACCTTCCTCAGTCTGG + Intronic
1031253894 7:119422929-119422951 CACATTGACTTTAGACAGCCTGG - Intergenic
1036012299 8:4740007-4740029 CACCCTGAGCTTCAGCATCCTGG + Intronic
1036811478 8:11869808-11869830 CACCTTGACCTCCAGCCTCCTGG - Intergenic
1038242537 8:25823238-25823260 CACCTTGATCTTGAACTTCCAGG + Intergenic
1039408397 8:37331804-37331826 CACCTTGACCTTGAACTTCTGGG - Intergenic
1041873525 8:62661826-62661848 CACCTGGAGCTACAACAGGCAGG - Intronic
1043272236 8:78349581-78349603 AACCCTGACATTCACCAGCCTGG + Intergenic
1045094875 8:98786872-98786894 CACATTGACCTTGGACGGCCTGG - Intronic
1046314710 8:112483979-112484001 CACCTTGACCTTCAACAGCCAGG - Intronic
1046326285 8:112651611-112651633 CACTGTGACCTTCACCTGCCGGG + Intronic
1050072213 9:1827239-1827261 CACCTTGATCTTCGACTTCCAGG + Intergenic
1050327486 9:4511242-4511264 CACCTTGATCTTGGACATCCTGG - Intronic
1050420307 9:5457280-5457302 GAGCTGGTCCTTCAACAGCCGGG - Exonic
1052601960 9:30645732-30645754 CACCTTGATCTTAAACTTCCAGG - Intergenic
1055834294 9:80420019-80420041 CACCTTGAACTGAAACATCCAGG - Intergenic
1059197092 9:112380270-112380292 ATCCTTGACCTCCCACAGCCGGG - Intronic
1061295289 9:129673732-129673754 CACCCTGACCACTAACAGCCAGG - Intronic
1062013388 9:134278817-134278839 CACTTTGTCCTTCAACACCATGG + Intergenic
1203781346 EBV:102653-102675 AACGGTGACCTTCGACAGCCCGG + Intergenic
1187118139 X:16374607-16374629 CACCTTGAACTTGAACTTCCAGG + Intergenic
1187412691 X:19064502-19064524 CCCCTTGGCCTTCAAAAACCAGG + Intronic
1191204949 X:57823797-57823819 CACTTTGACCTTAAACACCCTGG + Intergenic
1196527927 X:116749175-116749197 AGCCTTGACTTTCAACAGTCTGG + Intergenic
1199672362 X:150158192-150158214 CACCATGACAGTCAACATCCTGG + Intergenic
1200212704 X:154353927-154353949 CACCTTCACCGTCAACACCAAGG - Exonic