ID: 1046317926

View in Genome Browser
Species Human (GRCh38)
Location 8:112531212-112531234
Sequence GAGCAGTGGCCTGAAATCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046317926_1046317937 29 Left 1046317926 8:112531212-112531234 CCCCTGATTTCAGGCCACTGCTC 0: 1
1: 1
2: 2
3: 31
4: 297
Right 1046317937 8:112531264-112531286 TAGAAGGAAATCTGCTACCCTGG No data
1046317926_1046317932 13 Left 1046317926 8:112531212-112531234 CCCCTGATTTCAGGCCACTGCTC 0: 1
1: 1
2: 2
3: 31
4: 297
Right 1046317932 8:112531248-112531270 TAGATCCACCCCATGCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046317926 Original CRISPR GAGCAGTGGCCTGAAATCAG GGG (reversed) Intronic
900368666 1:2321819-2321841 GGGCTGTGGCCTGAGGTCAGAGG - Intronic
900872250 1:5312374-5312396 GGGCAGGGGCCTGACAGCAGAGG - Intergenic
900927558 1:5715750-5715772 GATCAGAAGTCTGAAATCAGTGG + Intergenic
901050107 1:6421733-6421755 AAGGAGTGGTCTGGAATCAGAGG + Intronic
901421632 1:9155088-9155110 GAGAAGAGGCCTGAACTCTGAGG + Intergenic
901430530 1:9211356-9211378 GAGCTGGGCCCTGAAATCCGAGG - Intergenic
902600354 1:17536693-17536715 GAGGAGGGGCCTTAAATCAGAGG + Intergenic
903256282 1:22103450-22103472 GAACACTGGCCTAAAAACAGAGG - Intergenic
903961019 1:27057848-27057870 CAGCAGAAGCCGGAAATCAGAGG - Intergenic
905879444 1:41454115-41454137 GAACTGTGGCCTGTGATCAGAGG - Intergenic
906468601 1:46107302-46107324 GTGCAGTGGCATGATCTCAGTGG - Intronic
907393978 1:54177031-54177053 GAGCTGTGGCCTGATGTCATGGG - Intronic
907457659 1:54585775-54585797 GAGCAGAGGCCTGTGATCGGGGG + Intronic
908702769 1:66920176-66920198 GAGAAGTGGCTTGACTTCAGAGG + Intronic
908782353 1:67702120-67702142 GAGCACTTACCTGAAGTCAGTGG - Exonic
909332089 1:74425703-74425725 GAGCAGCGTCCTGAAATATGGGG + Intronic
909521107 1:76568733-76568755 GAGCTGTGGCCTCAAATCCCAGG + Intronic
911056865 1:93716338-93716360 CAGCACTGGCCTGAAGTCAGCGG + Intronic
912759632 1:112355678-112355700 GAGCAGAAGCCTGAAGCCAGTGG - Intergenic
913042548 1:115041404-115041426 GAGCAGTGGCCTAGAAATAGGGG - Intergenic
915883570 1:159700084-159700106 GAGCAGAGGTCTGAAAACACAGG + Intergenic
916466386 1:165078187-165078209 GAGCAGTGGTTTGAAATCCTGGG - Intergenic
919120467 1:193334104-193334126 GGGTACTGGCCTGAAGTCAGGGG + Intergenic
921106469 1:211985669-211985691 GAGCCTAGGCCTGAACTCAGCGG - Intronic
921154569 1:212429120-212429142 GAGCAGGCGCCAGAGATCAGTGG - Intergenic
922371900 1:224919685-224919707 AAGCAGTGGCCCACAATCAGAGG + Intronic
922645409 1:227281441-227281463 GAGCCCTTGCCTGAAATCACAGG - Intronic
924804693 1:247352936-247352958 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1062866981 10:864071-864093 AAGCACAGGCCTGAAAGCAGGGG + Intronic
1064365175 10:14701066-14701088 TAGAAGTGGCTTAAAATCAGAGG - Intronic
1064408405 10:15084659-15084681 AAGTAGCGGCCTGCAATCAGAGG + Intronic
1064496115 10:15912084-15912106 GAGAAGTGGCCTCAAAACAAAGG + Intergenic
1065158530 10:22895034-22895056 GGGGTGTGGCCTGAAAGCAGTGG - Intergenic
1065567619 10:27030403-27030425 GAGCACTGGACTGAAAACACTGG + Intronic
1065582618 10:27186859-27186881 GAACAGTGAACTGAAATCAGAGG - Exonic
1068321725 10:55426867-55426889 GAGAAGTGGCTTGACTTCAGAGG - Intronic
1069137779 10:64785618-64785640 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1069579956 10:69559201-69559223 GAGTCGTGGCTTGAAAGCAGGGG - Intergenic
1070470604 10:76775476-76775498 GAGAAGTGGCTTGAATTCAGAGG - Intergenic
1072072339 10:91931217-91931239 GAACAGTTGCCTGAAATCACAGG + Intronic
1073616536 10:105002150-105002172 GACCAGTGGGCCAAAATCAGAGG - Intronic
1076058568 10:127395364-127395386 GATGAGTGGCCTCAAAACAGAGG - Intronic
1076969038 11:123104-123126 GTGCAGTGGCACGATATCAGTGG - Intergenic
1079172183 11:18106539-18106561 CAACAGTGGCCAGAGATCAGAGG - Intergenic
1080792145 11:35530999-35531021 GAGAAGTGGCTTGAACTGAGAGG + Intergenic
1081022792 11:37968311-37968333 GAGCAGTGGCTTGGCTTCAGAGG - Intergenic
1081412508 11:42776473-42776495 GAGAAATGGCCTGAAAGAAGGGG - Intergenic
1083650134 11:64198476-64198498 GCGCAGTGGCCTGTAATCCCAGG - Intronic
1085061876 11:73454728-73454750 GAGAAGTGGCTTGACTTCAGAGG + Intronic
1085686843 11:78631225-78631247 GAGCAATGGCCTGAAATCAGGGG + Intergenic
1085870789 11:80347111-80347133 GAGAAGTGGCTTGACATCAGAGG - Intergenic
1086286176 11:85253920-85253942 GAGAAGTGGCTTGACTTCAGAGG - Intronic
1087871175 11:103294844-103294866 GAGCAAAGGCCTGGAATCATAGG + Intronic
1088470160 11:110181829-110181851 CAGCAGTGGCCTGAAAAAAAAGG + Intronic
1089441690 11:118522904-118522926 AAGCAGTGGCATGAAGACAGGGG - Exonic
1090684127 11:129096726-129096748 GAGCATGGGCCTGCAAACAGTGG - Intronic
1090802234 11:130180109-130180131 GAGCCTTGGCCACAAATCAGTGG + Intronic
1091413279 12:258160-258182 GGCCAGTGGCCTGAAATCATAGG - Intronic
1091644311 12:2262283-2262305 AAGCAGTGGGCTGAAAGCTGTGG + Intronic
1092680088 12:10969212-10969234 GAGAAGTGGCTTGACTTCAGAGG - Intronic
1092850846 12:12625021-12625043 GAGAAGTGGCTTGACTTCAGAGG - Intronic
1094806499 12:34099454-34099476 AAGCAGAGGTCTGAAATCAAAGG + Intergenic
1095482071 12:42646691-42646713 GATCAGTGGGTAGAAATCAGAGG + Intergenic
1097664743 12:62466429-62466451 GACTAGTGGCCCCAAATCAGTGG - Intergenic
1097908683 12:64946546-64946568 GGGCAGTGGCCTGCCAGCAGTGG + Intergenic
1099540796 12:83904908-83904930 GAGAAGTGGCTTGACTTCAGAGG - Intergenic
1100245695 12:92754354-92754376 GAGCCATGACCTCAAATCAGTGG - Intronic
1100354522 12:93816938-93816960 GACTAGTGATCTGAAATCAGAGG + Intronic
1101672858 12:106892960-106892982 GAGCAGAGACCTGAAAGAAGCGG + Intergenic
1102954722 12:117052112-117052134 GATCAGTGGACAGAAAACAGGGG + Intronic
1103040038 12:117687387-117687409 GAACTGTTGCCTGAAATTAGTGG + Intronic
1103307869 12:119980525-119980547 GAGCAATTGCCTCAAAGCAGAGG + Intergenic
1103995813 12:124829325-124829347 GAGCAGAGGCAGGAAAACAGCGG - Intronic
1104219276 12:126766582-126766604 AAGGAGGGGCCTGAGATCAGAGG - Intergenic
1105938149 13:25120852-25120874 GAGCACTGGCCTGGAATCAAGGG - Intergenic
1107257814 13:38450813-38450835 CAGCAGTTGCTTGGAATCAGGGG - Intergenic
1108063785 13:46556852-46556874 GATCAGTGGCCAGCACTCAGAGG - Intronic
1108883677 13:55153364-55153386 TAACAGTGTCCTGCAATCAGTGG + Intergenic
1109741162 13:66557862-66557884 GAGAAGTGGGCTGGAAACAGTGG + Intronic
1110503009 13:76250896-76250918 GTGCAGTGGCATGATCTCAGTGG + Intergenic
1110565548 13:76954313-76954335 AAGCAATGTCCTGAAAGCAGTGG + Intronic
1111103946 13:83621900-83621922 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1111636233 13:90907691-90907713 GAGAAGTGGCTTGACTTCAGAGG - Intergenic
1112449588 13:99496721-99496743 AAGTGGTGGCCTGCAATCAGAGG + Intergenic
1113543925 13:111131671-111131693 GGGCAGTGACCTGAGGTCAGGGG + Intronic
1113840708 13:113359218-113359240 GAGCAGTGGGCTGACTTCAAAGG + Intronic
1114210716 14:20611934-20611956 GAGAAGTGGCAGGAAATCAAGGG + Intergenic
1114411825 14:22508030-22508052 GCGCAGTGGCCTGTAATCTTTGG - Intergenic
1114847228 14:26337817-26337839 CAGCATGGGCCTGAAATCAGAGG - Intergenic
1115153718 14:30314853-30314875 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1117185948 14:53241121-53241143 GAGCAGTGGCCAGAAATATAAGG - Intergenic
1119420705 14:74506247-74506269 GGGCAGTGGGCTGTAGTCAGGGG - Intronic
1119914104 14:78380648-78380670 GACCAGGAGTCTGAAATCAGAGG - Intronic
1120286935 14:82515110-82515132 AAGTAGTGGCCAGCAATCAGAGG - Intergenic
1121004037 14:90476246-90476268 GAGCAGTAGCCAGAGATCACTGG - Intergenic
1122731980 14:103807196-103807218 CAGCAGAGGCCTGAAAGAAGAGG - Intronic
1202888113 14_KI270722v1_random:127765-127787 GAGCAGTGTTCTGAAATCCTAGG + Intergenic
1124046646 15:26156473-26156495 GAGCAAAGCGCTGAAATCAGTGG + Intergenic
1125770747 15:42164227-42164249 GAGCACTGGCCTGAAATGCCTGG + Intronic
1129305336 15:74656868-74656890 GAGAAGTGGCTTGACTTCAGAGG + Intronic
1130979795 15:88804462-88804484 GAGCAGTGCCCTGAACACACGGG + Intronic
1131881522 15:96867626-96867648 GAGAAGTGGCTTGACATAAGAGG + Intergenic
1133284663 16:4685000-4685022 GAGCAGTGGCCTGTGCTCATGGG + Intronic
1133467208 16:6039121-6039143 GGCCAGTGGGTTGAAATCAGTGG + Intronic
1134065648 16:11226281-11226303 GAACAGTGGCCTTAAGTCACGGG + Intergenic
1136131248 16:28223198-28223220 TTGCAGTGAGCTGAAATCAGAGG - Intergenic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1137038242 16:35585824-35585846 GAGAAGAGACCTGAAATCACAGG + Intergenic
1137511231 16:49102509-49102531 GAGAAGTGGCCTGAAGTAAGAGG - Intergenic
1138852108 16:60641681-60641703 GAGAAGTGGCTTGACTTCAGAGG - Intergenic
1139654838 16:68381214-68381236 GAGCAGTGGCCTGGGGTTAGAGG - Intronic
1140838075 16:78813987-78814009 CAGCAGTTGCCTTAAACCAGCGG - Intronic
1142212323 16:88814215-88814237 GAGGAGGGTCCTGAAATCTGAGG + Exonic
1143174880 17:4949969-4949991 GAGGAGCGGCCTGAGATGAGGGG + Intronic
1143243801 17:5466467-5466489 GAGCTGAGGGCTGAAAGCAGGGG - Intronic
1144131064 17:12248374-12248396 AATCACTGGCCTGAACTCAGTGG + Intergenic
1144459780 17:15448981-15449003 GAACAGTGGCCTGATCACAGAGG - Intronic
1146720701 17:35121505-35121527 CAGCAGTAGCCTCAAATCAAGGG + Intronic
1148062162 17:44844377-44844399 CAGCAGTGGCCTGAATTCTCAGG - Intergenic
1148220131 17:45855303-45855325 GATCATTGGGCTGAAATCAAGGG - Intergenic
1148974212 17:51512583-51512605 AAGTGGTGGCCTGCAATCAGAGG - Intergenic
1149487075 17:57050845-57050867 GAGCAGTTGCTATAAATCAGGGG + Intergenic
1150348884 17:64426145-64426167 GAGCAGCTGCCAGAAATCACTGG + Intergenic
1150671791 17:67206964-67206986 GTGCAGTGGTATGATATCAGCGG + Intronic
1152021923 17:77784265-77784287 GAGCAGTGCCCTGACACCTGAGG - Intergenic
1152243785 17:79174952-79174974 GAGCTGAGGCCTGCAAGCAGGGG - Intronic
1154502291 18:15002920-15002942 GGGCAGGGGCCTGAAGGCAGGGG + Intergenic
1156713529 18:39977450-39977472 GAGAAGTGGCTTGACTTCAGAGG - Intergenic
1158014398 18:52766643-52766665 GAGAAGTGGCTTGACTTCAGAGG - Intronic
1158208698 18:55022903-55022925 GAGCAATGCCCAGTAATCAGAGG - Intergenic
1158804100 18:60948245-60948267 GAGTAGTGGCCTTACATAAGAGG - Intergenic
1159030540 18:63226160-63226182 GAGAAGTGGCTTGAGTTCAGAGG - Intronic
1159272291 18:66168491-66168513 GAGCAATGGCCTGGAATCAGAGG - Intergenic
1162014231 19:7835699-7835721 GAACAGCGGCTTGAATTCAGAGG - Intronic
1163790945 19:19305848-19305870 GAGCAGTGGCTGGAGATCAAAGG - Exonic
1163843525 19:19626368-19626390 GAGCAGAGGCCTGAATGCTGAGG - Intronic
1164951360 19:32339816-32339838 AAGCAGTTTCCTGAAAACAGTGG - Intergenic
1165110714 19:33500478-33500500 GAGAAGTGGATTGAAGTCAGGGG + Intronic
1166306162 19:41938194-41938216 GGGCTGGGGCCTGAAATCTGGGG - Intergenic
1167447794 19:49548737-49548759 GATCAGTGAGCTGAGATCAGTGG - Intergenic
1167829651 19:52008846-52008868 GAGAAGTGGCCAGAAATTAAGGG + Intergenic
1202663503 1_KI270708v1_random:94512-94534 GAGCAGTGTTCTGAAATCCTAGG + Intergenic
1202663510 1_KI270708v1_random:94560-94582 GAGCAGTGTTCTGAAATCCTAGG + Intergenic
927510744 2:23642502-23642524 GAGTAGTGGCCTGGCATCAGCGG - Exonic
928676039 2:33652794-33652816 GAGCAGTGGCTGGCAATCCGGGG + Intergenic
929443378 2:41983720-41983742 GAGCAGAGGAGTGATATCAGTGG + Intergenic
929918757 2:46157369-46157391 GAGCAGTGGCCTTTAACTAGGGG + Intronic
930023376 2:47014737-47014759 GAGCAGGGGACAGAAATCTGGGG + Intronic
931778728 2:65562087-65562109 CAGCAGCTGCCTGAAAGCAGCGG - Intergenic
931938934 2:67230791-67230813 GAGAAGTGGCTTGATTTCAGAGG + Intergenic
932451809 2:71815452-71815474 GAGCAGAGGCCTGAACCCTGAGG - Intergenic
933114293 2:78447207-78447229 GGGCACCGGCCTGGAATCAGGGG + Intergenic
933198647 2:79422284-79422306 GAGCAGTGGCTCTAAACCAGGGG + Intronic
933475975 2:82790821-82790843 GAGAAGTGGCTTGACTTCAGAGG - Intergenic
936053729 2:109244812-109244834 GAGGGGTGGCCTGAGAACAGGGG + Intronic
937712410 2:124993470-124993492 GAGCAGCAGCCAGAAATCAGTGG - Intergenic
939504311 2:143026896-143026918 GAGAAGTGGCTTGACTTCAGAGG - Intronic
940816566 2:158303809-158303831 GAGCTGTGGCCTTGATTCAGTGG + Intronic
941427610 2:165368234-165368256 GAGAAGTAGCTTGACATCAGAGG - Intronic
943382602 2:187170572-187170594 GAGAAGTGGCTTGACTTCAGGGG - Intergenic
943384510 2:187184825-187184847 GAGAAGTGGCTTGACTTCAGAGG - Intergenic
943557325 2:189421627-189421649 GGGCACTGGCCTGGAGTCAGGGG - Intergenic
946621371 2:221567419-221567441 GGGCAATTGCCTGCAATCAGTGG + Intronic
947461055 2:230305687-230305709 GAGCAGTGGCCACACTTCAGGGG + Intronic
948429899 2:237912535-237912557 GAGGAGGGGTCTGAACTCAGGGG - Intergenic
948796915 2:240409419-240409441 GAGAAGTGGGCTGATCTCAGGGG + Intergenic
1168987166 20:2059457-2059479 GAGCAGTGGAAGGAAATCAGAGG + Intergenic
1169923222 20:10757099-10757121 AAGCACTGGCAGGAAATCAGAGG - Intergenic
1169932463 20:10849106-10849128 GAGCAGTGACATGAAAACTGAGG - Intergenic
1170018754 20:11812675-11812697 AAGTGGTGGCCTGCAATCAGAGG + Intergenic
1173275286 20:41575077-41575099 AAGTAGTGGCCTGCAATCAGAGG - Intronic
1174953406 20:55067556-55067578 GGGGAGTGGCATGAAACCAGGGG - Intergenic
1178163428 21:29945092-29945114 GAGCAGTGAGCTGTAGTCAGTGG - Intergenic
1178223668 21:30689621-30689643 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1180330242 22:11471441-11471463 GAGCAGTGTTCTGAAATCCTAGG + Intergenic
1183873612 22:40759993-40760015 GAGCTGTGGCTTGAACTTAGTGG - Intergenic
1184044901 22:41966976-41966998 CAGCCTTGGGCTGAAATCAGTGG - Intergenic
1184660156 22:45961962-45961984 GAGCAGTGGCGTGGAAAGAGTGG - Intronic
1184841091 22:47052786-47052808 GAGCAGTGGCCTGGAAGGACAGG - Intronic
949402872 3:3683971-3683993 GAGCAGTGGCTTTCAACCAGGGG + Intergenic
949956667 3:9274832-9274854 GAGAAGTGGCTTGACTTCAGAGG - Intronic
950119235 3:10470814-10470836 GTCCAGTGGCCTGGAATCAAAGG - Intronic
951125887 3:18982888-18982910 GAGCTAGGGCCTGGAATCAGAGG + Intergenic
951251139 3:20395426-20395448 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
951319323 3:21225917-21225939 GAGAAGTGGCCTGACTTCAGAGG + Intergenic
951569185 3:24044303-24044325 GAGCAGTGGGCAGAAGCCAGGGG + Intergenic
951822020 3:26824633-26824655 GAGCTGTAGCTGGAAATCAGTGG - Intergenic
952849917 3:37719463-37719485 GAGCTGTGGACTGAGAACAGAGG - Intronic
953478249 3:43224890-43224912 GAGCAGTAGCCTTATTTCAGTGG + Intergenic
954149663 3:48651089-48651111 GGCCAGGGGCCTGAAGTCAGAGG + Intronic
955971786 3:64444672-64444694 GAGCAGTTGGCTCAAATCACAGG - Intronic
957672526 3:83324041-83324063 GAGCTAGGGCCTGGAATCAGGGG + Intergenic
957746312 3:84347632-84347654 GAGCCGTGGCCTGATATTTGGGG + Intergenic
960325061 3:116285489-116285511 GAGCAGAGTCCTGAAAGAAGAGG - Intronic
961466470 3:127084858-127084880 GAAGGGTGGCCTGAAGTCAGTGG + Intergenic
961720232 3:128889541-128889563 CAGCAGTTGCCTGGAAACAGGGG - Intronic
962814254 3:138984213-138984235 GAGCATGGGTCTGAAATGAGGGG + Intergenic
963451692 3:145490320-145490342 GAGAAGTGGCTTGACTTCAGGGG + Intergenic
964468247 3:157022589-157022611 GAGCTGTGTCCTGAAATAAGAGG + Intronic
965388473 3:168074394-168074416 GAGCAGAGGCCTGAATAAAGAGG + Intronic
968147051 3:196308209-196308231 GGGCAGTGGCAAGAAATCACTGG + Intronic
968607143 4:1540867-1540889 CAGGAAGGGCCTGAAATCAGTGG - Intergenic
969046263 4:4338973-4338995 GAGCATTGTTCTGAAATCTGAGG - Intergenic
970644074 4:18099169-18099191 TAGCAGTGGCTTGAACTAAGAGG + Intergenic
971076088 4:23151555-23151577 GAGAAGTGGCTTGATGTCAGAGG + Intergenic
971273101 4:25170187-25170209 GAGGAGTGGACTGGAATGAGGGG - Intronic
972271063 4:37511147-37511169 GAGCCAAGGCCTGGAATCAGGGG + Intronic
973207534 4:47576952-47576974 CAGAAGTGGTCAGAAATCAGAGG + Exonic
974489821 4:62550566-62550588 GTGCAGTGGCATGATCTCAGCGG + Intergenic
974922922 4:68264537-68264559 GAGCAGCAGCCAGAAATCACTGG - Intergenic
975387130 4:73770542-73770564 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
975697870 4:77031632-77031654 TAGCAGCTGCCTGAAACCAGTGG + Intronic
976228807 4:82819113-82819135 GAGAACTGGCATGAAAGCAGAGG + Exonic
977338721 4:95730212-95730234 GAGAAGTGGCTTGACTTCAGAGG - Intergenic
977827583 4:101551933-101551955 GAGAAGTGGCTTGACTTCAGAGG + Intronic
978335241 4:107660339-107660361 GAGAGGTGGCCTCAAATAAGAGG + Intronic
979031820 4:115658338-115658360 GAGCAGAGGCCTGGAACCAGGGG + Intergenic
981880534 4:149605940-149605962 GAGCAAAGGCCTGGAATCAGGGG - Intergenic
982107773 4:152025613-152025635 GAGGAGTGGGCAGAAATAAGAGG - Intergenic
982861999 4:160463900-160463922 GAGGAGTGGCTTGACTTCAGAGG - Intergenic
983262419 4:165471274-165471296 GAGCTGTGGCCAGAGATCACTGG + Intronic
983462667 4:168047216-168047238 GAGAAGTGGCTTGACTTCAGAGG - Intergenic
983491572 4:168396422-168396444 GAGCAGTGGCCAGAGCACAGTGG + Intronic
983904942 4:173172260-173172282 GCGCAGTGGCCTGCCAGCAGCGG + Intronic
984105561 4:175541215-175541237 GAGAAGTGGCCTGACTTCAGGGG - Intergenic
984520124 4:180791965-180791987 GAGCAGTGGAAGGAAAACAGAGG + Intergenic
985048918 4:185970460-185970482 GAGAAGTGGCTTGACTTCAGAGG - Intergenic
986645873 5:9915514-9915536 GAGAACTGGACTGAAATCTGCGG + Intergenic
986872417 5:12064723-12064745 GAGCACTAACCTGAAATCTGAGG - Intergenic
988231368 5:28483903-28483925 GAGAAGTGGCTTGACTTCAGAGG - Intergenic
988561524 5:32285887-32285909 GAGGAGTGGCCCAAAATCACAGG + Intronic
989085014 5:37666708-37666730 CAGAGGTAGCCTGAAATCAGAGG + Intronic
989147639 5:38264541-38264563 GGGCAGTGGCCAGGGATCAGGGG + Intronic
990176561 5:53114578-53114600 GAGAAGTGGCTTGATTTCAGAGG - Intergenic
990938934 5:61180920-61180942 CAGCTGTGGCATGGAATCAGCGG + Intergenic
993297041 5:86153682-86153704 GAGAAGTGGCTTGAATTTAGGGG - Intergenic
993595681 5:89852108-89852130 GAGCATTGGCCTGACTGCAGTGG - Intergenic
996194322 5:120584958-120584980 GACCAGGGGCTTGAAATCAGAGG - Intronic
998006934 5:138663303-138663325 GAGCAGGGGCGTAAATTCAGGGG - Intronic
998715447 5:144878849-144878871 GACCAGTGGCCTTAATACAGGGG - Intergenic
1000810660 5:165857382-165857404 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1001332450 5:170771999-170772021 GAGCAGTGGCCTTAGGTCAGGGG - Intronic
1002202664 5:177539007-177539029 GAGCTTTGGCATGAAGTCAGGGG + Exonic
1002278189 5:178116335-178116357 GAGGAGTGTCCTGAAAGCTGGGG + Intronic
1002795005 6:465237-465259 CAGCTGTGGCCTGAAGACAGAGG + Intergenic
1004013358 6:11710425-11710447 AAGCAGTGGGCTGAAATCCTGGG + Intergenic
1006313667 6:33278164-33278186 GAGCAGTGGCCTCACACCTGGGG + Exonic
1006366526 6:33619466-33619488 CAGCAGAGGCCTGACATCACAGG + Intergenic
1006809455 6:36810559-36810581 GAAGAGTGGCCTGAGATCTGGGG + Intronic
1007493373 6:42241805-42241827 GTGCAGTGGCCTGAGATTACAGG + Intronic
1007786670 6:44284154-44284176 GAGCAGAGGCCAGATAGCAGTGG - Intronic
1010475813 6:76286177-76286199 GAGCAAAGGCCTGAAATCAGAGG + Intergenic
1010555265 6:77271740-77271762 GTGCCATGGACTGAAATCAGAGG - Intergenic
1010718605 6:79258178-79258200 GAGCACTGGCCAGAGATCACTGG + Intergenic
1012057069 6:94426685-94426707 GAGCTATGGTCTGAAATGAGGGG + Intergenic
1012263259 6:97111908-97111930 GAGAAGTGGCTTGACTTCAGAGG - Intronic
1012805524 6:103887754-103887776 TGGCAGTTGGCTGAAATCAGCGG + Intergenic
1015489173 6:133805936-133805958 GAGCTGAGGCCTGAAACCTGAGG + Intergenic
1016935338 6:149445575-149445597 GAGCAGTGCCCTCAAAGAAGGGG - Intergenic
1017551042 6:155507757-155507779 GAGCAGTGTGTTGAAATCACTGG + Intergenic
1018707793 6:166475581-166475603 GATCAGTGGCCCCAAACCAGTGG + Intronic
1020057241 7:5126431-5126453 GAACAGTTGCCTGAAACAAGAGG + Intergenic
1020170516 7:5841233-5841255 GAACAGTTGCCTGAAACAAGAGG - Intergenic
1020680871 7:11234936-11234958 GAGCAGTGGCCTGCTAGCACTGG + Intergenic
1021213933 7:17892110-17892132 GATCAGTGGCCTGAAAATTGGGG + Intronic
1021329074 7:19312505-19312527 AAGCAGTGCCCTGAACTCAGGGG - Intergenic
1022273562 7:28833989-28834011 AATCAGTGCCCTGAATTCAGTGG - Intergenic
1022679642 7:32532209-32532231 GAGAAGTGGCTTGACTTCAGAGG - Intronic
1024125599 7:46291320-46291342 GAGTTGTGGGCTGAGATCAGGGG - Intergenic
1024336474 7:48211762-48211784 AAGCAAAGGCCTGGAATCAGGGG + Intronic
1024417614 7:49125597-49125619 CAACACTGGCCTGAAATCAGGGG - Intergenic
1024677452 7:51649739-51649761 GAGCAATGCCCAGAAATCTGTGG - Intergenic
1025128180 7:56362246-56362268 GTGCAGTGGCATGATCTCAGTGG - Intergenic
1026919547 7:74145019-74145041 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1028033525 7:85949762-85949784 GACCTATGGCCTGAAATCAGGGG + Intergenic
1028972610 7:96875662-96875684 GAGCCAAAGCCTGAAATCAGGGG - Intergenic
1029094039 7:98071132-98071154 GAGCTCTGGCATGAGATCAGAGG + Intergenic
1029341237 7:99946410-99946432 GGGCAGTGGCCTGAAACCTGGGG - Intergenic
1029934255 7:104406781-104406803 AAGCAATGGCCTCAAACCAGTGG + Intronic
1032701834 7:134388112-134388134 GAGCAGCTTTCTGAAATCAGAGG + Intergenic
1033120357 7:138662663-138662685 GAACAGAGGTCTGATATCAGTGG - Intronic
1034023430 7:147670575-147670597 GAGAAGTGGCTTGACTTCAGAGG + Intronic
1034150666 7:148912782-148912804 GAGCAATGGCCGGGAGTCAGAGG + Intergenic
1034252862 7:149706352-149706374 GAGCAGTGTCCTGAAAGCAAAGG - Intergenic
1035184020 7:157111863-157111885 GAGAAGTGGCTTGAGTTCAGGGG - Intergenic
1037427406 8:18771056-18771078 GAGAAGTGGCTTGACTTCAGAGG - Intronic
1038386921 8:27156993-27157015 GAGCAATGGCAAGACATCAGAGG - Intergenic
1038843772 8:31210207-31210229 AAGTAGTGGTCTGCAATCAGAGG - Intergenic
1039661354 8:39470739-39470761 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1040388660 8:46931885-46931907 GAGCAGCGGCCAGAAGACAGGGG - Intergenic
1040614466 8:49020427-49020449 GAGCAGTGTCAGGTAATCAGGGG - Intergenic
1041871888 8:62644120-62644142 GAGCAATGGCATGAAGTCAAGGG - Intronic
1042081564 8:65059811-65059833 GAGAAGTGGCCTGACTTCAGAGG + Intergenic
1042857944 8:73286085-73286107 CAGCAGTGACCTGAAGGCAGAGG - Intergenic
1043807157 8:84685903-84685925 GGACAGTGAGCTGAAATCAGAGG + Intronic
1044286835 8:90419867-90419889 GAGAAGCGGCTTGACATCAGAGG - Intergenic
1044325421 8:90852666-90852688 GAGAAGTGGCTTGACTTCAGAGG + Intronic
1046317926 8:112531212-112531234 GAGCAGTGGCCTGAAATCAGGGG - Intronic
1046398746 8:113676146-113676168 GAGAAGTGGCCTGACTTCAGAGG + Intergenic
1046438711 8:114230553-114230575 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1046922762 8:119750412-119750434 CAGAAGTGTCCTGAAAACAGTGG - Intronic
1047342761 8:123999002-123999024 GAGTGAAGGCCTGAAATCAGGGG + Intronic
1047390759 8:124449080-124449102 AAGTAGTGGCCTGCAATCAGAGG + Intergenic
1047878812 8:129170163-129170185 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1048331206 8:133471874-133471896 GGGCAGGGGGCGGAAATCAGGGG + Intronic
1050944379 9:11499228-11499250 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1052593673 9:30531351-30531373 GAGAAGTGGCTTGACTTCAGAGG - Intergenic
1053717689 9:40913324-40913346 GAGCAGTGTTCTGAAATCCTAGG - Intergenic
1053717725 9:40913751-40913773 GAGCAGTGTTCTGAAATCCTAGG - Intergenic
1056122666 9:83504607-83504629 GAGGAGAGGCCTGAAAGAAGTGG - Intronic
1056426794 9:86485429-86485451 GGGCAGTGGCCTGAAATTCATGG - Intergenic
1056557300 9:87700291-87700313 AAGCAGTTCCCTGAAACCAGAGG - Intronic
1057882347 9:98802049-98802071 GAGCACTGGCAGGAGATCAGAGG - Intergenic
1061084805 9:128392706-128392728 GACCAGGGCCCTGAACTCAGGGG - Intergenic
1186003599 X:5042540-5042562 AAGCAATGGCCAGAAATCAGAGG + Intergenic
1186087136 X:6002855-6002877 GAGAAGTGGCTTGACTTCAGAGG + Intronic
1186515739 X:10165089-10165111 ATGCAGTGGCCTGCAATCGGGGG + Intronic
1187048542 X:15674274-15674296 GAGCAGGGGGCTGCAAACAGAGG + Intergenic
1188116781 X:26254351-26254373 GAGAAGTGGCTTGACTTCAGAGG + Intergenic
1189628194 X:42921607-42921629 GAGCCAAGGCCTGGAATCAGGGG - Intergenic
1190507859 X:51145431-51145453 GATCTATGGCCTGGAATCAGGGG + Intergenic
1190533489 X:51404826-51404848 GTGCAATGGCCTGAAATAAATGG - Intergenic
1191057265 X:56254740-56254762 GAGAAGTGGCTTGACTTCAGAGG - Intronic
1193117339 X:77788135-77788157 AAGTAGTGGCCCGCAATCAGAGG + Intergenic
1193386835 X:80882966-80882988 GAGGTGTGGCCTGAATGCAGTGG + Intergenic
1195858914 X:109359537-109359559 GAGCAGAGGCCTTAAAGAAGGGG + Intergenic
1196737302 X:118991123-118991145 GTGCAGTGGCCTGTAATCCCAGG - Intronic
1197593818 X:128442872-128442894 GAGCAGTGGCCTTAGATCCAAGG - Intergenic
1197785537 X:130193368-130193390 GTGCAGTGGCGTGATCTCAGTGG - Intergenic
1198092560 X:133346062-133346084 AAGTAGTGGCCTGCAATCAGAGG + Intronic
1199460323 X:148076812-148076834 GAGCTGTGTCTTGAAAACAGAGG + Intergenic
1200094132 X:153649407-153649429 GAGCTGTGGCCTGGATTCGGAGG + Exonic