ID: 1046319699

View in Genome Browser
Species Human (GRCh38)
Location 8:112556909-112556931
Sequence GATCCTGGCATTCCACAATT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046319699_1046319701 4 Left 1046319699 8:112556909-112556931 CCAAATTGTGGAATGCCAGGATC 0: 1
1: 0
2: 1
3: 8
4: 155
Right 1046319701 8:112556936-112556958 CAGTGTGAGAGTTCAAAACCTGG 0: 1
1: 0
2: 0
3: 12
4: 204
1046319699_1046319702 5 Left 1046319699 8:112556909-112556931 CCAAATTGTGGAATGCCAGGATC 0: 1
1: 0
2: 1
3: 8
4: 155
Right 1046319702 8:112556937-112556959 AGTGTGAGAGTTCAAAACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 171
1046319699_1046319704 29 Left 1046319699 8:112556909-112556931 CCAAATTGTGGAATGCCAGGATC 0: 1
1: 0
2: 1
3: 8
4: 155
Right 1046319704 8:112556961-112556983 CAAAAATATAAATTGATTAAAGG 0: 1
1: 0
2: 17
3: 212
4: 2211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046319699 Original CRISPR GATCCTGGCATTCCACAATT TGG (reversed) Exonic
900355462 1:2260027-2260049 GATCCAGCCATTCCACACCTAGG - Intronic
905246036 1:36614588-36614610 GATCCTCTCATTTTACAATTGGG + Intergenic
905889313 1:41509680-41509702 CATCCTGGCACTCCACAGGTGGG - Exonic
910312495 1:85840185-85840207 GATCCTGGCATACCTAAATCTGG + Intronic
913084007 1:115417810-115417832 AATCCTGCAATTCCACATTTAGG + Intergenic
913273264 1:117114767-117114789 GTTCCTGACATACCATAATTAGG + Intronic
914355795 1:146883142-146883164 GACCCAGCCATTCCACAACTAGG - Intergenic
915945305 1:160146025-160146047 TATCCTTGCATTCCACCATTTGG - Intergenic
917689341 1:177451318-177451340 GATCCAGACATTCCACTCTTAGG + Intergenic
918404429 1:184197467-184197489 GATCCTGGCAGCACAAAATTTGG - Intergenic
918867353 1:189920226-189920248 CATCCTGACAATCCACATTTTGG + Intergenic
920536537 1:206740912-206740934 GATCTTGCCATTCCACTACTAGG - Intergenic
920723214 1:208409402-208409424 GATCTAGGCATTCCACTCTTAGG + Intergenic
923595129 1:235355361-235355383 GATCCTGGCATGCCACGTATAGG + Intergenic
924389375 1:243535736-243535758 GATCCAGGAATTCCACTAGTAGG - Intronic
1062781945 10:220210-220232 GACCCTGACATTCCAAATTTGGG - Intronic
1067762656 10:49059644-49059666 GATTCTGGCATTTCAGACTTGGG - Intronic
1069113361 10:64474031-64474053 GATCCAGCCATTCCACTATTGGG + Intergenic
1073077541 10:100833751-100833773 GATCCTGGAAATCCAAAAATGGG - Intergenic
1074937432 10:118196092-118196114 GATCCAGCCATTCCACTACTAGG - Intergenic
1075563918 10:123489604-123489626 AATCCTGACATGCCACAATGTGG - Intergenic
1075718527 10:124571323-124571345 GAGCCAGGAATTCCACAACTAGG - Intronic
1078022839 11:7669874-7669896 GATCCGGGCATCCCATATTTGGG - Intronic
1078376221 11:10795513-10795535 GATACTGCCATTCCACAGTATGG + Intergenic
1079462901 11:20699794-20699816 GATCCAGCAATTCCACTATTGGG - Intronic
1079860421 11:25663250-25663272 GATTTTGGCATTCCTCATTTTGG + Intergenic
1079888165 11:26015831-26015853 GATACTTGCATTTCAAAATTGGG + Intergenic
1083017233 11:59467780-59467802 GACCCAGCAATTCCACAATTGGG - Intergenic
1086369444 11:86141744-86141766 CATCCTAGCAATCCACAAGTTGG + Intergenic
1088346252 11:108829105-108829127 GATCCAGACATCCCACTATTAGG - Intronic
1090629176 11:128631574-128631596 GATCCAGCCATTCCACTTTTAGG - Intergenic
1092594207 12:9983171-9983193 GATCCAGCAATTCCACTATTGGG - Intronic
1092696364 12:11175939-11175961 GATCCAGGCATTCACAAATTTGG - Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1097291460 12:57919666-57919688 TTTCCTGGCATTCGACAAATAGG + Intergenic
1097773987 12:63624469-63624491 GATCCTGGCATCCCAGGCTTTGG + Intronic
1102020360 12:109678066-109678088 GATCCTGGAATGCCAGAGTTTGG + Intergenic
1103015525 12:117491746-117491768 GTTCCTGCAATTCCACGATTGGG - Intronic
1106044385 13:26124643-26124665 GATCCAGTAATTCCACATTTAGG - Intergenic
1107195234 13:37643337-37643359 GATCTTGGCAATCCACCTTTTGG - Intronic
1107199770 13:37700333-37700355 GATCCTGGCCTTCCATGAATGGG + Intronic
1107264420 13:38535987-38536009 GATCAAGGCATTCTCCAATTTGG - Intergenic
1107322093 13:39200925-39200947 GCTCCTTGCATTCTACAACTAGG - Intergenic
1111756620 13:92404697-92404719 GGTCTTGGCATTCCAAAACTGGG + Intronic
1113287054 13:108861530-108861552 GATGCTGGCATTCCACTCCTAGG - Intronic
1117856040 14:60034860-60034882 GATCCAGCCATTCCACTACTGGG - Intronic
1118242538 14:64074088-64074110 GATCCTGGAATGCCATATTTTGG - Exonic
1125865330 15:43042159-43042181 GATCCAGCAATTCCACATTTGGG + Intronic
1126333028 15:47554504-47554526 GATCCTGGCCTTCCATAGATGGG + Intronic
1128593804 15:68927042-68927064 TAAACTGGAATTCCACAATTAGG + Intronic
1137973393 16:53008478-53008500 GATCCAGGAATCCCACCATTGGG + Intergenic
1139407666 16:66731890-66731912 GCTTCTGGCATTTCACATTTTGG - Intronic
1139978222 16:70832302-70832324 GACCCAGCCATTCCACAACTAGG + Intronic
1143228066 17:5324985-5325007 GATCCAGCAATTCCACTATTGGG + Intronic
1144020035 17:11232753-11232775 GATACTGGTAGTCCAAAATTAGG - Intergenic
1144937214 17:18909587-18909609 GATCCAGCCATTCCACTCTTAGG + Intronic
1148221117 17:45862884-45862906 GACCCAGGAATTCCACAACTTGG + Intergenic
1155403921 18:25467312-25467334 GATCCTTGCATTCCTCTCTTTGG + Intergenic
1155501949 18:26495299-26495321 GATAATTGCATTCAACAATTTGG - Intronic
1158906820 18:62021126-62021148 GATCCAGGCATTTCACACCTAGG + Intergenic
1164023056 19:21326191-21326213 GATCCAGCAATCCCACAATTGGG + Intronic
1164150923 19:22550414-22550436 GATCCAGCAATTCCACTATTGGG + Intergenic
1164237252 19:23347984-23348006 GATGTTGGCAGTCCAAAATTGGG - Intronic
926475056 2:13311478-13311500 GATGCTGGCCTTACAAAATTAGG + Intergenic
926477578 2:13345619-13345641 GATCCAGCCATTTCACACTTAGG + Intergenic
928898354 2:36291565-36291587 GATCCTGGCATTCACAAAGTAGG + Intergenic
929985526 2:46728044-46728066 GATCCTGGCAGTTAACAGTTAGG - Intronic
932643480 2:73476412-73476434 GATCCAGGAATTCCACTTTTGGG - Intronic
933173692 2:79154423-79154445 GATAATAGCATTCCAGAATTGGG - Intergenic
933570862 2:84010003-84010025 GATCCAGGAATTCCACTACTGGG + Intergenic
934020269 2:87943116-87943138 GATCCAGCAATTCCACTATTGGG - Intergenic
937813513 2:126224975-126224997 GACCCTGCAATTTCACAATTTGG + Intergenic
940011069 2:149056226-149056248 TATCCTGCCTTTCCACAATTTGG + Intronic
940028403 2:149233858-149233880 GATCCAGCAATTCCACTATTGGG + Intergenic
940706688 2:157114154-157114176 GATCCAGGAATTCCACTACTGGG + Intergenic
940747789 2:157589046-157589068 GATCCAGCAATCCCACAATTGGG - Intronic
943478659 2:188390135-188390157 GATCCAGCCATTCCACTACTGGG - Intronic
945997522 2:216450604-216450626 TATCATGGCATTCTACAATTTGG - Intronic
946678859 2:222192185-222192207 GATCATGGCACTGCACAATCTGG + Intergenic
946687708 2:222288207-222288229 TCTCCTGGCATTCAACAACTGGG + Intronic
948086497 2:235254470-235254492 GATACTTGCATTCCACATGTAGG + Intergenic
1171965505 20:31527036-31527058 GATCCTGCCATTCTACCATGAGG - Intronic
1172418463 20:34791938-34791960 GATCCTGGCAGTCCCCCACTGGG - Intronic
1172441213 20:34967883-34967905 GATCCTGGGATTTCACATGTGGG + Intergenic
1174846502 20:53948371-53948393 GATGCTGGCATTTAAAAATTAGG + Intronic
1178759226 21:35384663-35384685 GAGCCTGTCCTTCCACATTTGGG - Intronic
1182372025 22:29817906-29817928 GATCACTGCAGTCCACAATTGGG + Intronic
1183110777 22:35646981-35647003 GCTCCTGGCCTCCCACACTTGGG - Intergenic
949315778 3:2753134-2753156 GATCCAGCAATTCCACAACTGGG - Intronic
949327908 3:2887931-2887953 GATTCTGGCATGCTCCAATTTGG - Intronic
954281481 3:49582006-49582028 GATCCAGGAATTCCACTCTTAGG - Intronic
955624105 3:60898372-60898394 AATCCTGCAATTCCACATTTAGG - Intronic
956247563 3:67201132-67201154 GATCCTTGCATTTCAAAGTTTGG + Intergenic
957703799 3:83753726-83753748 GATCCAGAAATTCCACATTTGGG - Intergenic
959717953 3:109454051-109454073 GATCCTGCCATTCCACTGCTAGG + Intergenic
960633860 3:119763444-119763466 GATCCAGCAATTCCACAACTGGG + Intronic
961206072 3:125082713-125082735 GATCCTGCAATTCCACTTTTGGG + Exonic
962738590 3:138347079-138347101 GATCCAGGAATTCCACTCTTAGG + Intergenic
963394256 3:144712143-144712165 GATCCAGCCATTCCACTACTGGG - Intergenic
964994558 3:162860286-162860308 GATCCAGGAATTCCACTGTTGGG + Intergenic
966230651 3:177648019-177648041 TTTCCTGGCTTTCCACAATGCGG - Intergenic
969205869 4:5645039-5645061 GATCCAGCCATTCCACTACTGGG - Intronic
970486914 4:16534019-16534041 GATCGTGGCATTCCACACAAAGG - Intronic
970513559 4:16804918-16804940 GATGCTGGAAATCCAAAATTGGG + Intronic
974205395 4:58696145-58696167 GATCCAGCAATTCCACTATTTGG + Intergenic
976073964 4:81275482-81275504 GATCCAGCCATTCCACTATTGGG + Intergenic
977023229 4:91783276-91783298 GACCCAGCCATTCCACATTTAGG + Intergenic
977995150 4:103492356-103492378 GAGCCTGTCATTTCACACTTGGG + Intergenic
978686098 4:111445197-111445219 GATCCTGCAATTCCACTTTTGGG + Intergenic
979000336 4:115209326-115209348 GATCCAGGAATTCCACTACTAGG + Intergenic
979497950 4:121405886-121405908 GATCCAGCAATTCCACTATTGGG - Intergenic
979902909 4:126246265-126246287 GATCCTGCAATCCCACTATTAGG + Intergenic
982629568 4:157814717-157814739 GATCCAGCAATTCCACTATTGGG + Intergenic
985232144 4:187830677-187830699 GATCCAGCAATTCCACTATTGGG - Intergenic
985434186 4:189913165-189913187 GATCTTGGGATGCCACAACTAGG + Intergenic
987128851 5:14841931-14841953 AATCCTAGAATTCCAGAATTAGG + Intronic
987704874 5:21449725-21449747 GATCCAGCAATTCCACTATTGGG + Intergenic
988820418 5:34878820-34878842 GATCCAGGAATCCCACTATTAGG + Intronic
990353929 5:54946446-54946468 GATCCAGGCATGCCACAAATTGG - Intergenic
992189847 5:74281083-74281105 GATTCTGGCTTTCTGCAATTTGG - Intergenic
993948844 5:94148819-94148841 GATCCAGCAATTCCACTATTGGG + Intergenic
996763765 5:127014433-127014455 GATCCAGCAATCCCACAATTGGG + Intronic
999824043 5:155257342-155257364 GAACCAGGCATTCCAGAAATAGG - Intergenic
1005804002 6:29456590-29456612 GACCCTGAAATTCCACAAATAGG + Intronic
1007999480 6:46343726-46343748 GACCCAGGAATTCCACTATTAGG + Intronic
1010389995 6:75325885-75325907 GATCCAGCAATTCCACTATTGGG + Intronic
1010833764 6:80561944-80561966 GATCCAGCCATTCCACTTTTAGG - Intergenic
1012779675 6:103541717-103541739 GATCCTGGCATCCCAAAAACTGG - Intergenic
1013026628 6:106280220-106280242 GACCCAGCCATTCCACAACTAGG + Intronic
1015578141 6:134694653-134694675 GATCCAGGCATTCCACTGTGAGG - Intergenic
1022364331 7:29696593-29696615 GATCCTGGCATCCCAGGCTTTGG - Intergenic
1024225068 7:47320394-47320416 AATCCTGGTATTCCACGAGTTGG + Intronic
1024847401 7:53663064-53663086 GATCCAGGAATTCCACTACTGGG - Intergenic
1026240440 7:68569710-68569732 GATCCAGCAATTCCACTATTGGG + Intergenic
1027555377 7:79658222-79658244 GATCCAGCAATTCCACAGTTGGG + Intergenic
1027572708 7:79890827-79890849 GATCCAGACATTCCACCCTTAGG + Intergenic
1029294568 7:99529578-99529600 GATCCAGCAATTCCACAACTGGG - Intronic
1035685189 8:1519007-1519029 GATCCTGGCACTCAAAATTTCGG - Intronic
1035791580 8:2310839-2310861 GGTCCTGCCATTCCACCATGTGG + Intergenic
1035801225 8:2410866-2410888 GGTCCTGCCATTCCACCATGTGG - Intergenic
1035915490 8:3616734-3616756 GATCCTGGGATTCCAGAAAATGG - Exonic
1036572046 8:9988795-9988817 GATCCTGCAATTCCACCACTGGG + Intergenic
1037667025 8:20978604-20978626 GTTCCTGGCATGCCCCACTTTGG - Intergenic
1039078937 8:33717180-33717202 GATCATGCCATTGCACAATCTGG + Intergenic
1040439944 8:47430597-47430619 GCTCCTGGCATTCCACAGGATGG + Intronic
1040606054 8:48932390-48932412 CATCCTGGCATTCAACAATCAGG - Intergenic
1046319699 8:112556909-112556931 GATCCTGGCATTCCACAATTTGG - Exonic
1046325381 8:112636960-112636982 GATCCTGGCATTCCTCAATATGG - Exonic
1050353283 9:4760528-4760550 GATTTTGCCATTCCACAATGTGG - Intergenic
1056433363 9:86550688-86550710 GAAATTGGCATTTCACAATTGGG - Intergenic
1058198261 9:102006452-102006474 GATCCAGCAATTCCACTATTGGG - Intergenic
1058274825 9:103026846-103026868 GATCCAGAAATTCCACTATTGGG - Intergenic
1058974669 9:110114861-110114883 GCTCCTGGGATTCCACAGTCGGG + Intronic
1188321908 X:28749276-28749298 GATCCAGTCATCCCACTATTGGG - Intronic
1189434204 X:40976940-40976962 GATCCTGCAATTCCACTACTGGG - Intergenic
1189874787 X:45424603-45424625 GGTCCAGGCATTGGACAATTAGG + Intergenic
1190020273 X:46868013-46868035 GATCCAGCAATTCCACAACTGGG - Intronic
1194432181 X:93822537-93822559 GATCCAGCCATTCAACATTTAGG - Intergenic
1194531766 X:95057768-95057790 CATACTGGCATTCCAAAACTGGG + Intergenic
1195549820 X:106155458-106155480 GATCCAGTCATTCCACCATTAGG + Intergenic
1195833020 X:109081277-109081299 GATCCTGCAATCCCACTATTGGG + Intergenic
1196238218 X:113307767-113307789 GATCCAGCAATTCCACTATTGGG + Intergenic
1197291230 X:124660858-124660880 GACCCCGTCATTCCACAACTTGG + Intronic
1197376150 X:125684126-125684148 GATCCAGCAATTCCACAACTGGG + Intergenic
1199124254 X:144096012-144096034 GATCCAGCAATTCCACTATTGGG + Intergenic