ID: 1046324396

View in Genome Browser
Species Human (GRCh38)
Location 8:112621543-112621565
Sequence GGTCACCAATGGTTTCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046324392_1046324396 7 Left 1046324392 8:112621513-112621535 CCACTCTGACACTGAAGCTGCCT 0: 1
1: 0
2: 1
3: 26
4: 243
Right 1046324396 8:112621543-112621565 GGTCACCAATGGTTTCCTTGTGG No data
1046324389_1046324396 26 Left 1046324389 8:112621494-112621516 CCTCCCATTTTCTCAATCTCCAC 0: 1
1: 0
2: 1
3: 23
4: 354
Right 1046324396 8:112621543-112621565 GGTCACCAATGGTTTCCTTGTGG No data
1046324390_1046324396 23 Left 1046324390 8:112621497-112621519 CCCATTTTCTCAATCTCCACTCT 0: 1
1: 0
2: 3
3: 33
4: 473
Right 1046324396 8:112621543-112621565 GGTCACCAATGGTTTCCTTGTGG No data
1046324391_1046324396 22 Left 1046324391 8:112621498-112621520 CCATTTTCTCAATCTCCACTCTG 0: 1
1: 0
2: 0
3: 52
4: 489
Right 1046324396 8:112621543-112621565 GGTCACCAATGGTTTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046324396 Original CRISPR GGTCACCAATGGTTTCCTTG TGG Intronic
No off target data available for this crispr