ID: 1046329053

View in Genome Browser
Species Human (GRCh38)
Location 8:112690458-112690480
Sequence TCGTGTCCTGGTCATGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046329053 Original CRISPR TCGTGTCCTGGTCATGATTC AGG (reversed) Intronic
910261938 1:85301645-85301667 TGGGGTCCTGGTTAGGATTCTGG + Intergenic
912499890 1:110114751-110114773 TCCTGTCCTGGTCCTGCTCCTGG + Intergenic
915282291 1:154830765-154830787 TGGTGTCCTGGTCATCATGCTGG - Intronic
923386407 1:233469697-233469719 TAGTATCATGGACATGATTCAGG - Intergenic
1065232883 10:23617259-23617281 TTGTTTCCTAGTCATCATTCTGG - Intergenic
1085016562 11:73177797-73177819 CCGGGTTCTGGTCCTGATTCTGG - Intergenic
1094720826 12:33062187-33062209 TAGTGTCCTTTTCCTGATTCAGG - Intergenic
1100448532 12:94683219-94683241 TCTTGACATGGTCCTGATTCTGG + Intergenic
1103096736 12:118138063-118138085 TCGTGGGATGGTCTTGATTCAGG + Exonic
1106258489 13:28043300-28043322 TGGTGTCCTGGTCCTGATAAAGG - Intronic
1119946727 14:78703046-78703068 TAGTGCCATGGTCATGATTATGG - Intronic
1120634822 14:86938728-86938750 ACGTATCCTGGTCATGCTTGGGG + Intergenic
1126399859 15:48257712-48257734 TCGTTTCCTGGGCATGGTCCAGG - Intronic
1127378336 15:58405744-58405766 ACCTGTCCCTGTCATGATTCAGG - Intronic
1127580677 15:60336702-60336724 TCGTGTCCTTCTCCTGATTGAGG - Intergenic
1131158689 15:90090560-90090582 TGGTGACCTGGTCATCAGTCTGG + Exonic
1133022831 16:2974376-2974398 TTCTGTCCTTGTCATGATGCTGG - Exonic
1137841765 16:51647613-51647635 TCGTCTCCAGGTGGTGATTCGGG + Intergenic
1138319554 16:56100283-56100305 TGGTGTCCTGGACAGGATCCTGG + Intergenic
1139654115 16:68377047-68377069 TGGTGTCCTGGGCACGGTTCTGG + Intronic
1140646120 16:77032047-77032069 TCTTGTCCTGGATAGGATTCAGG + Intergenic
1142917688 17:3155504-3155526 TCCTGTCCTGTTTAAGATTCTGG - Intergenic
1145956503 17:28858465-28858487 TAGTGTCCTGGTCATGAACAAGG + Exonic
1151444449 17:74153994-74154016 CTGTGTCCTGGTCTAGATTCTGG - Intergenic
1152449185 17:80365644-80365666 TCGTGGCATGGTCATGTTCCAGG + Intronic
1162730375 19:12715094-12715116 CCGTGCCCTGGTGATGCTTCTGG - Exonic
1165657836 19:37549529-37549551 TCGTGTGCTGGTCTTCTTTCTGG - Intergenic
930331961 2:49996381-49996403 TCCTGTCCTCCTCTTGATTCAGG - Intronic
949023269 2:241753047-241753069 CCCTGTCCTGGTCATGAACCCGG - Intronic
1169805122 20:9551468-9551490 ACGTGTCCTGGCCAGGAATCAGG + Intronic
1173040141 20:39454298-39454320 CCGAGTCCTGGACCTGATTCAGG + Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
949373174 3:3357457-3357479 TCCTTTCCTACTCATGATTCTGG + Intergenic
951545962 3:23825636-23825658 TTGGGTCCTTGTCATCATTCAGG - Intronic
952367080 3:32684580-32684602 TGGTGTCCTGGACAGGATCCTGG + Intergenic
954845238 3:53550168-53550190 ACGTGCCCTGGTCAGCATTCTGG - Intronic
967016892 3:185490417-185490439 TGTTTGCCTGGTCATGATTCAGG + Exonic
969348317 4:6582884-6582906 TTGTGGCCTGGTCATTATACTGG + Intronic
980059364 4:128112392-128112414 TCTTGTCCTGAGCATGTTTCAGG + Intronic
985732286 5:1556102-1556124 CCATGTCCGGGTCATGATCCAGG + Intergenic
992492090 5:77255311-77255333 TCGTGTCCTGGCTATGCTACAGG + Intronic
993711391 5:91229208-91229230 TCCTGCCCTGGACATGAATCTGG + Intergenic
996867585 5:128144063-128144085 TCATGTCCAGCTAATGATTCAGG + Intronic
1000945560 5:167418575-167418597 TCATGTCCTGTTCATTGTTCTGG - Intronic
1001654911 5:173341999-173342021 TGGTGCCCTGGAGATGATTCAGG - Intergenic
1003089548 6:3090350-3090372 TAGTCTCCTGTTCATGATTATGG - Intronic
1003637750 6:7848842-7848864 TTGTGTCCTTGTGATGATGCAGG + Intronic
1012038855 6:94177875-94177897 TCCTGTCCTGGGCATGAATGTGG - Intergenic
1015916826 6:138226130-138226152 ACATGTCCTGGTCATGATCGGGG - Intronic
1024294158 7:47829677-47829699 TGGAGTCCTGTTCATGATTAGGG - Intronic
1024837597 7:53541212-53541234 TTGTGTCCTTATCATGCTTCAGG + Intergenic
1034113160 7:148557893-148557915 TGGTGTCCTGCTCTTGATCCTGG + Intergenic
1038365373 8:26926671-26926693 TGGTATCCTGGACAGGATTCTGG + Intergenic
1042376246 8:68056144-68056166 AAGTTTCCTGGTCATGATCCTGG - Intronic
1043868952 8:85408139-85408161 CCTTGTCCTGTTCCTGATTCTGG - Intronic
1045295675 8:100870097-100870119 TAGTCTCCTGGTTCTGATTCAGG - Intergenic
1046329053 8:112690458-112690480 TCGTGTCCTGGTCATGATTCAGG - Intronic
1053160696 9:35811477-35811499 TCTGGTCCTGGTCATGGCTCTGG - Exonic
1193865102 X:86721079-86721101 TGGTTTCCTGGGCAGGATTCAGG - Intronic
1195788777 X:108558464-108558486 TCCTGTCCTGGTGATGATAAAGG + Intronic