ID: 1046330750

View in Genome Browser
Species Human (GRCh38)
Location 8:112712131-112712153
Sequence AGATGAGAGTGGCACAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046330750 Original CRISPR AGATGAGAGTGGCACAACAC TGG (reversed) Intronic
903633144 1:24792330-24792352 ATAGGAGAGTGCCACCACACTGG + Intronic
909375200 1:74932934-74932956 AGATGAATGAGGCAGAACACAGG + Intergenic
912222171 1:107690519-107690541 TGATGAGACTGGTACAACACTGG + Intronic
913352721 1:117879843-117879865 AGATGAGGGTGGAGAAACACGGG + Intronic
918158588 1:181875083-181875105 AGATGATAGTGGAATAAAACTGG + Intergenic
918320081 1:183355869-183355891 AGAGGATAATGGTACAACACTGG - Intronic
918325912 1:183410598-183410620 AGATGAGAGAGCCAGAAAACAGG - Intronic
920433704 1:205935152-205935174 AGATGAGAGTGGAAAGACCCTGG + Intronic
921353248 1:214259594-214259616 AGAGGAGAGTGACTCAGCACAGG - Intergenic
921986514 1:221318388-221318410 AGATGGGAGTGGCACCAAAATGG + Intergenic
1068137333 10:52964142-52964164 AGATGGCAGTGGCACAACCATGG - Intergenic
1068721361 10:60249913-60249935 AGAATAAAGTGGCAGAACACAGG - Intronic
1070112420 10:73498208-73498230 AGATGAGAATAGCACAACCATGG + Exonic
1071062790 10:81592654-81592676 AGATGACAGTGGAATAAAACTGG + Intergenic
1072167559 10:92828845-92828867 AGATGAAAGTGGCCCACCCCTGG - Intergenic
1073632150 10:105159855-105159877 TGATGAGAGTGGTTCATCACTGG - Intronic
1074777703 10:116778439-116778461 AGATGAGGGTGGCACACCTCAGG + Intergenic
1078708162 11:13764974-13764996 AGATCAGAGAGGGAGAACACTGG - Intergenic
1079103010 11:17553063-17553085 AGCTGAGATTGGCAGAACCCAGG - Intronic
1081486310 11:43532497-43532519 AAAGGACAGTAGCACAACACTGG + Intergenic
1081884163 11:46480502-46480524 GGATGAGGGTTGCACAACCCTGG - Intronic
1082140276 11:48601014-48601036 AGATCACAGTGGAACAAAACTGG - Intergenic
1082567445 11:54697983-54698005 AGATCACAGTGGAACAAAACTGG - Intergenic
1085072448 11:73559709-73559731 AGATGGTTGTTGCACAACACTGG + Intronic
1087688713 11:101295155-101295177 AGATCACAGTGGAACAAAACTGG - Intergenic
1088660585 11:112041940-112041962 AGATGAGATTGGAAAAAAACAGG + Intronic
1088770058 11:113025751-113025773 AAATGAGATTGGAACGACACAGG + Intronic
1088987545 11:114923152-114923174 AGATGGGAGTGCGACAAGACAGG + Intergenic
1089223086 11:116891773-116891795 AGATTAGAGGGGGACAAGACTGG + Intronic
1090788830 11:130071957-130071979 AGATGAGAGTGGCCTAAATCAGG + Intronic
1096932482 12:55228386-55228408 AAATGATAGTGCCCCAACACTGG + Intergenic
1100993483 12:100276381-100276403 AGAGGAGAGTGGCACAATCATGG + Intronic
1103068496 12:117920147-117920169 AGAGGAGAGTGGCACAATCATGG + Intronic
1106325745 13:28687431-28687453 AGATCAGAGTGGAATAAAACTGG - Intergenic
1107948076 13:45437588-45437610 AGTGGAGGGTGGCACAACAGAGG - Intergenic
1109487287 13:63042969-63042991 AGATGATAGTGGCTAGACACAGG + Intergenic
1109988080 13:70016632-70016654 GGCTGAGAGTGGCTCAGCACAGG + Intronic
1117495323 14:56296644-56296666 AGAGGAGAGTGGCCCCACACAGG - Exonic
1119276324 14:73360026-73360048 TGATGAGAGAGGGACAACAGAGG - Intronic
1119527552 14:75334182-75334204 AGATGGGAGTGGAAGAACCCGGG - Intergenic
1122161237 14:99785520-99785542 AGATGGGAGTCGCAGAAAACTGG + Intronic
1124831013 15:33149210-33149232 AGATGAGTGTGGAAGAACACTGG - Intronic
1125008691 15:34846705-34846727 AGATGATGGTTGCACAACATCGG - Intergenic
1125374056 15:39010274-39010296 AGAGAAGAGTGTCACAACCCAGG + Intergenic
1125747851 15:42009422-42009444 AGATTAGAGTGGGGCAAGACAGG - Intronic
1127258732 15:57312461-57312483 AGATGGGAGTGGCAGAGCTCAGG - Intergenic
1128196829 15:65765151-65765173 AGATGAGGCTGACACAAAACTGG + Intronic
1129026600 15:72580913-72580935 ACATGAGTGTGGCACGACACTGG - Exonic
1131247633 15:90809388-90809410 AGAGGTGACTGGCACACCACTGG - Intronic
1132792264 16:1698184-1698206 AGAAGAGAGGGGCACAAGAGAGG + Intronic
1133760555 16:8795339-8795361 ATATGTGAGGGGCACAGCACAGG + Exonic
1133866015 16:9644082-9644104 AGAGGAGGGTGGTAAAACACAGG + Intergenic
1136031694 16:27507761-27507783 AGATGAGAGTGGCATGTCAGGGG + Intronic
1139235986 16:65339798-65339820 TCATGTGAGTCGCACAACACCGG + Intergenic
1139794764 16:69473516-69473538 TGAAGAGAGTGGCAGTACACAGG + Intergenic
1139888468 16:70228821-70228843 AGAGGGCAGTGGCACAACCCGGG + Intergenic
1148512509 17:48184528-48184550 AGATGAGAGTGGCAACAGAGGGG + Intronic
1152324183 17:79626118-79626140 ACATGACAGTGGGAGAACACAGG + Intergenic
1153320102 18:3764510-3764532 AGTTGAGAGAGGTACATCACAGG - Intronic
1153428833 18:4993183-4993205 ACCTGAGGGTGGCTCAACACAGG - Intergenic
1153918501 18:9766904-9766926 GGATTACAGTGGCACAACATCGG - Intronic
1155985883 18:32230144-32230166 AGATAAAACTGGCACAAGACAGG - Intronic
1156366485 18:36432202-36432224 AGATCAGAGTAAAACAACACGGG - Intronic
1157097827 18:44702332-44702354 AGATGACACTTGAACAACACGGG - Intronic
1159939230 18:74393819-74393841 AAATGATGGTGGGACAACACTGG + Intergenic
1160401314 18:78613406-78613428 AGCTGAGAGTGGGAGAACAGTGG + Intergenic
1164949267 19:32322740-32322762 AGATGAATGAGGCACAACCCAGG - Intergenic
1165710786 19:38009369-38009391 AGAGGAGAGTGCCTCCACACTGG - Intronic
927089379 2:19698975-19698997 ACAAGAGAGTTGCACAACACTGG + Intergenic
927280039 2:21296858-21296880 ACAGGAGAGTCTCACAACACAGG - Intergenic
928236985 2:29551926-29551948 TGATGATAGTTGCACAACATTGG - Intronic
934126510 2:88898075-88898097 TGATGAGTGTGGCAAAAGACAGG - Intergenic
934150105 2:89138366-89138388 AGATGAGAGTGGTACAGAAGGGG - Intergenic
934217190 2:90043663-90043685 AGATGAGAGTGGTACAGAAGGGG + Intergenic
936251706 2:110872904-110872926 AGAAGAGAGTGACACCTCACGGG + Intronic
942796928 2:179832134-179832156 AGATGAGAGTTGGACAAGTCTGG + Intronic
942959965 2:181818812-181818834 AGATCAGAGTGCCATAACAAGGG + Intergenic
944097704 2:195987924-195987946 AGATAACAGTTGCACAAAACTGG + Intronic
946608136 2:221428963-221428985 AGATGAGAGGAGAACACCACAGG + Intronic
948422698 2:237870294-237870316 AGATCAGAGTTGCACAGGACGGG - Intronic
1170009017 20:11700567-11700589 AGATGAGAATAACATAACACAGG + Intergenic
1173050471 20:39554950-39554972 TGATGATTGTGGTACAACACTGG + Intergenic
1174076183 20:47938893-47938915 GGATGGGAGTGGGACAACAAGGG + Intergenic
1175499640 20:59440790-59440812 AAATGGGAGTGGCACAGCAGAGG - Intergenic
1175528528 20:59655356-59655378 TGATGATAGTTGCACAACTCTGG - Intronic
1176230563 20:64030541-64030563 AGATGAGAGAGGCTCCCCACAGG + Intronic
1177219810 21:18177813-18177835 GGTTTAGAGTGGCACATCACTGG + Intronic
1181007139 22:20019148-20019170 GGATGAGAGAGGGAGAACACTGG - Intronic
1181471061 22:23140201-23140223 AGGTGAGCGTGACACAGCACAGG - Exonic
1183868830 22:40725215-40725237 AGATGAGGGTGGCAGAAGAAAGG - Intergenic
1184739768 22:46421135-46421157 ACATGAGCCTGGCACAAGACAGG + Intronic
949679464 3:6495952-6495974 AAATGAGAATTACACAACACAGG - Intergenic
954704262 3:52470758-52470780 AGATGGCACTGGCACAACAGAGG + Intronic
955548215 3:60055005-60055027 AGAGGACAGTTGCCCAACACAGG + Intronic
957140846 3:76354263-76354285 AGAAGAAAGTGCCACAACTCTGG + Intronic
958964897 3:100548350-100548372 AGATGATAGTGCCAAGACACAGG - Intronic
959231960 3:103666178-103666200 GGATCAGAGAGGCACAACAATGG - Intergenic
960104591 3:113780943-113780965 ATATGAGAGAGGCACAATACTGG + Intronic
961332047 3:126148127-126148149 AGATGAGAGTGGAGCCACAAAGG + Intronic
963982497 3:151555312-151555334 AGATGAGACAGACAAAACACTGG + Intergenic
964382959 3:156116232-156116254 AGATGAGAGTGGCTTAGAACAGG - Intronic
964714376 3:159706361-159706383 GGAAGAGAGAGGCACAGCACAGG + Intronic
965882741 3:173406789-173406811 AAAGGAGAGTGGCACACCTCTGG - Intronic
967059222 3:185856974-185856996 AGATGACAGAGGAACAACCCAGG + Intergenic
971406116 4:26321575-26321597 ACAAGAGTGTGGCACAACAAAGG - Intronic
971724656 4:30294853-30294875 ACATGAAAGTGGCACAAAAAAGG - Intergenic
973338987 4:48985739-48985761 AGCTGAGAGTGGCCCAGCAGTGG + Intergenic
975173284 4:71258143-71258165 AGGAGAGAATGGCACATCACAGG - Intronic
975961404 4:79910822-79910844 AGATGAGAGTAGCACAGAAGAGG + Intronic
977303594 4:95296532-95296554 ATATGAAATTGGCACAACAATGG + Intronic
985139903 4:186829248-186829270 AGATGATAATGGAGCAACACAGG - Intergenic
989659520 5:43785191-43785213 AGATGAGAGTAGCACAGCATAGG - Intergenic
990563665 5:57008052-57008074 AGATGCCAGAGGCACAAAACGGG + Intergenic
991342641 5:65628313-65628335 AGAAGACAGTGTCACAAAACTGG + Intronic
994609282 5:102015664-102015686 AGATAAGAGTGGAAAAAAACTGG - Intergenic
996059866 5:119021412-119021434 AGATGAGAGTGGCAGGAGGCAGG - Intergenic
996078173 5:119222891-119222913 AGATGTGAATGGTACAACAGAGG - Intronic
997611354 5:135217987-135218009 ACATGAGAGGGGCCCAACTCAGG + Intronic
998333135 5:141346787-141346809 TGATGAGAGAAACACAACACTGG + Intronic
999132795 5:149297327-149297349 GGATCAGAGTGGCACAGCTCTGG - Intronic
999322398 5:150623804-150623826 AGATGAAAGTGGAACCACCCTGG + Intronic
1004485716 6:16064688-16064710 AGATGAGTACGGCACAACGCTGG - Intergenic
1005737081 6:28757839-28757861 AGATGAGAGTGGCAGGACGCTGG - Intergenic
1005878512 6:30034892-30034914 AGATGAGGTTGGTAGAACACGGG - Intergenic
1011141464 6:84162528-84162550 AACTTAGAGTGGCAGAACACAGG - Intronic
1014672868 6:124328869-124328891 AGATGTGACTGGCACACCACAGG + Intronic
1015431156 6:133131671-133131693 GGATGAGTGAGGCACAACACGGG - Intergenic
1016684794 6:146868909-146868931 ATATGAGAATGGAACAGCACTGG + Intergenic
1017537844 6:155367467-155367489 AGATGAGATGGGCTCAACATGGG + Intergenic
1018595150 6:165471308-165471330 AGGTGAGTGTGGCTCAACCCTGG - Intronic
1018817206 6:167342592-167342614 AGGTGATGGTTGCACAACACGGG + Intronic
1020663673 7:11012507-11012529 AGTTGACAATGGAACAACACAGG - Intronic
1023518974 7:41031842-41031864 AGAGAAGAGTGCCACAACAAGGG - Intergenic
1025780796 7:64600214-64600236 AGAGGAGAGTGACATCACACAGG - Intergenic
1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG + Intergenic
1028794664 7:94889623-94889645 AGAGGAGAGTAGCTCATCACTGG - Intergenic
1029101237 7:98132007-98132029 AGATGAGCCTGGAACAACCCAGG + Intronic
1031775020 7:125897885-125897907 ACATGATAGTGGCTTAACACAGG + Intergenic
1032797231 7:135287711-135287733 AGAGGAGAGAGACACATCACGGG - Intergenic
1032917219 7:136505574-136505596 AGATGTGTGTAGCATAACACGGG + Intergenic
1033786336 7:144735668-144735690 AGAAGAGAGAGGCACTAAACTGG + Intronic
1034435950 7:151062850-151062872 AGCTGGGACTGGCAGAACACCGG - Intronic
1036916746 8:12811522-12811544 ACATGAGAGTGTCACTGCACTGG - Intergenic
1038120109 8:24603633-24603655 ACCTGAGAGTGGCACAAGCCAGG + Intergenic
1038700476 8:29845084-29845106 AGCTGAGAGTGACACAAAGCTGG + Intergenic
1038873393 8:31520660-31520682 GGAGGAGAGTGGCAAAACACTGG - Intergenic
1041469475 8:58192850-58192872 AGATGAGACAGGAATAACACAGG + Intronic
1041905705 8:63031433-63031455 AGATTAGACTGGCAGAATACTGG - Intronic
1043861423 8:85321738-85321760 AGATGAGAGAGGAAAAAGACTGG - Intergenic
1045634627 8:104169998-104170020 AGATGAGAGTGGAATAAAACTGG - Intronic
1046330750 8:112712131-112712153 AGATGAGAGTGGCACAACACTGG - Intronic
1047325998 8:123836423-123836445 AGGTGAGAGTGGCTCAAAGCAGG - Intergenic
1048494440 8:134923446-134923468 AGATGTGTGTGGCACAGCCCAGG + Intergenic
1050045131 9:1535154-1535176 AGGTGACGGTTGCACAACACTGG - Intergenic
1055056348 9:72027802-72027824 AGGTGTGAGTGGCCCAAAACAGG + Intergenic
1055669103 9:78582745-78582767 AGTTGAGAGTTCCACAACCCAGG + Intergenic
1057232799 9:93335041-93335063 GGGTGTGAGTGGCACCACACCGG + Intronic
1057252713 9:93516580-93516602 GGGTGTGAGTGGCACCACACCGG - Intronic
1060289435 9:122286909-122286931 GGATGACAGTGGCACAAGACTGG - Intronic
1062460980 9:136662488-136662510 AGATGTGTGTGACACAGCACGGG - Intronic
1187663840 X:21581557-21581579 AGATGAGAGTGACTTAACCCTGG + Intronic
1190230866 X:48580874-48580896 AGGTAAGAATGGCAGAACACTGG - Intergenic
1192151282 X:68714122-68714144 AGATGAGAGTGCAAGAGCACAGG - Intronic
1192585975 X:72318484-72318506 AGATGAGAGTGACTCAGCCCAGG - Intergenic
1193821677 X:86172753-86172775 AGAAGAGAGAAGCACTACACAGG + Intronic
1196792256 X:119474735-119474757 AGGTGAGAGAGCCAGAACACAGG + Intergenic
1198681513 X:139187823-139187845 AAATGAGAGTGGCATAATTCAGG + Intronic
1199354304 X:146843127-146843149 AGGTGAGAGTGGAATAACAAAGG - Intergenic
1201731093 Y:17204052-17204074 AGGTGATTGTTGCACAACACTGG + Intergenic
1202068311 Y:20963189-20963211 AAATGAGAGTCACACAACATAGG + Intergenic