ID: 1046333531

View in Genome Browser
Species Human (GRCh38)
Location 8:112753423-112753445
Sequence CATTCTTTCCAGAAATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 287}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046333531_1046333536 2 Left 1046333531 8:112753423-112753445 CCTTCCTATTTCTGGAAAGAATG 0: 1
1: 0
2: 1
3: 21
4: 287
Right 1046333536 8:112753448-112753470 CATAATTCGGCAGCAGGGTCAGG No data
1046333531_1046333538 11 Left 1046333531 8:112753423-112753445 CCTTCCTATTTCTGGAAAGAATG 0: 1
1: 0
2: 1
3: 21
4: 287
Right 1046333538 8:112753457-112753479 GCAGCAGGGTCAGGGTTGATAGG No data
1046333531_1046333534 -4 Left 1046333531 8:112753423-112753445 CCTTCCTATTTCTGGAAAGAATG 0: 1
1: 0
2: 1
3: 21
4: 287
Right 1046333534 8:112753442-112753464 AATGAACATAATTCGGCAGCAGG No data
1046333531_1046333537 3 Left 1046333531 8:112753423-112753445 CCTTCCTATTTCTGGAAAGAATG 0: 1
1: 0
2: 1
3: 21
4: 287
Right 1046333537 8:112753449-112753471 ATAATTCGGCAGCAGGGTCAGGG No data
1046333531_1046333535 -3 Left 1046333531 8:112753423-112753445 CCTTCCTATTTCTGGAAAGAATG 0: 1
1: 0
2: 1
3: 21
4: 287
Right 1046333535 8:112753443-112753465 ATGAACATAATTCGGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046333531 Original CRISPR CATTCTTTCCAGAAATAGGA AGG (reversed) Intronic
902231677 1:15031382-15031404 TATTCTCTCCAGGAAAAGGACGG + Intronic
903616618 1:24663948-24663970 CAGTCTTTCCAGTACTAGAAAGG + Intronic
906093158 1:43199993-43200015 CATGATTTCAAGAAATAAGAAGG - Intronic
906252314 1:44319978-44320000 CATTGTTTCTGGAAATGGGAAGG + Intronic
906793369 1:48677875-48677897 CCTTCTTTCCAGAAATCCGGAGG - Intronic
907265445 1:53257199-53257221 CATTCTTTCATGACATGGGAGGG - Intronic
907427930 1:54392800-54392822 CTTTCATTCCAGAAAGGGGAAGG + Intronic
907795043 1:57707951-57707973 CACTCTTTCCCCAAATTGGAAGG + Intronic
907893853 1:58665026-58665048 AATTCTTTCCTGAGATAGAATGG + Intronic
909988172 1:82188263-82188285 GATTCTGTCCAAAAATAGCAGGG + Intergenic
910029363 1:82698702-82698724 AAATATTTCGAGAAATAGGAAGG - Intergenic
910353333 1:86324941-86324963 CATTCATTCAAGAAATAATAAGG - Intergenic
912119984 1:106459138-106459160 CATGCTTTTCAGAAAGAGGATGG + Intergenic
915238790 1:154504475-154504497 CATTCCTACCAGCAATATGAGGG + Intronic
915999266 1:160598988-160599010 CATTCTGTCTAGATCTAGGAAGG - Intergenic
917932671 1:179834137-179834159 CCTTGTTTCCAGAAAATGGAAGG + Intergenic
918673201 1:187246849-187246871 AATTCTTTCCAAAAATTGAAGGG - Intergenic
921346867 1:214195362-214195384 CATTCTCTCCAGAAATTACAGGG - Intergenic
921485031 1:215704736-215704758 CATCCTTTCCAGGCATAGAAGGG - Intronic
921930482 1:220750226-220750248 AAGTCTTTCCAGTAATAGGAAGG - Intronic
923073841 1:230591667-230591689 CATTCATTCCAGAAATTTGCAGG + Intergenic
923896996 1:238282121-238282143 CATTCTAACCAGATTTAGGATGG + Intergenic
924351271 1:243116670-243116692 CATTTTTTCCAGAAATCTGGGGG + Intergenic
924661162 1:246018533-246018555 CAATTTTTACAGAAATATGATGG - Intronic
924830589 1:247590204-247590226 CCTTATTTCCAGAAAAAGAATGG - Intergenic
1062901358 10:1149078-1149100 CATTCTCTCCAGAAGGAGGCTGG - Intergenic
1066710294 10:38226398-38226420 GATTTTTTCCAGAATTGGGAAGG + Intergenic
1067205597 10:44209436-44209458 ATTTCTTTCCAGATATAAGATGG - Intergenic
1067813587 10:49451776-49451798 AACTCTTTCAAGAAATAGGAGGG - Intergenic
1069988299 10:72298731-72298753 TATTCTTCCCAGGAAGAGGAAGG + Intergenic
1070071487 10:73094597-73094619 CATTCCTTCCACAGAAAGGAAGG + Intronic
1071996301 10:91153049-91153071 TATTTTTTCCAGAAATAGGGTGG + Intergenic
1072255948 10:93620453-93620475 CATTCTATGCAGTCATAGGATGG + Intronic
1072269086 10:93757771-93757793 AATTGTTACCAAAAATAGGACGG - Intergenic
1072446378 10:95502264-95502286 TATTTTTTCCATAAATAGAAAGG - Intronic
1072487146 10:95866354-95866376 ATATCTTTCCAGAAATATGAAGG - Exonic
1072606323 10:96986080-96986102 TATTATTTCCAGTAATAGAAAGG + Exonic
1072663865 10:97380247-97380269 CCTTTTTTCCAGCAATGGGAGGG + Intronic
1072930930 10:99661100-99661122 AATTCTGTCAAGAAACAGGATGG - Intronic
1073652188 10:105373023-105373045 CATTCTTTTGAGATTTAGGAAGG - Intergenic
1075226732 10:120636207-120636229 CCTTCCTTCCTGAAATAGCAAGG + Intergenic
1078187456 11:9064520-9064542 CATTTTTTTCAGAAATATGGGGG + Intronic
1082802094 11:57422390-57422412 CATTCTTTCATGAAATCAGAAGG + Intronic
1084231039 11:67753367-67753389 AATTCTTTCCAGATTTACGATGG - Intergenic
1084505328 11:69563257-69563279 CATTCTTTGGAGAAAAAGTATGG - Intergenic
1086014508 11:82150417-82150439 TATTTTTTCCAGCAATAAGATGG + Intergenic
1087098265 11:94340468-94340490 CATTCTTTACAGAATTATAAGGG + Intergenic
1087308272 11:96508842-96508864 CATTCTTTACAGAGAGAGAAGGG + Intergenic
1089967941 11:122669241-122669263 CATTCTTTCCAGGAAGAACACGG - Intronic
1090146948 11:124335137-124335159 CAGTCTTTTCTGGAATAGGAGGG - Intergenic
1090651024 11:128806115-128806137 AATTCTTTCAAGAAAGAGGTTGG + Intronic
1092103928 12:5907586-5907608 CATTCATTCAGAAAATAGGAAGG + Intronic
1093181317 12:15970605-15970627 CATTATTTTCAAAAATAGAATGG - Intronic
1093311825 12:17598043-17598065 CAAGCTTTCAAGAAATAAGAGGG + Intergenic
1093866240 12:24230300-24230322 CATTGTTCTCAGAAACAGGAGGG - Intergenic
1095810788 12:46372029-46372051 TTTTCTTTCCGGACATAGGAGGG - Intronic
1097332429 12:58346135-58346157 CATTCTTTCTACAAATAAAATGG - Intergenic
1098281388 12:68866133-68866155 CATTTTTTCCAGAATTGGGGTGG - Intronic
1099571742 12:84329727-84329749 AATAATTTCCAGAAATACGAAGG - Intergenic
1100386725 12:94110648-94110670 CAGTTTTTCCACAAATGGGAGGG - Intergenic
1101842534 12:108338848-108338870 CATTGTTTAAAGAAATAGCAAGG - Intronic
1103749253 12:123148411-123148433 CATTTTTTCCAAAAACAGCAAGG + Intronic
1104768856 12:131347351-131347373 CATTCATTTCAGAAAGTGGAGGG - Intergenic
1106164283 13:27228729-27228751 CATTCTTACCAGCAACATGAGGG + Intergenic
1107240432 13:38227699-38227721 CATTTTTTCCAGAAATACACAGG + Intergenic
1107475201 13:40729227-40729249 CATTGTTTTCAAAAATATGATGG - Exonic
1107487839 13:40847758-40847780 CATTTGTTCCAGAAATAAGTTGG + Intergenic
1108336094 13:49443823-49443845 CATCCTTTCCGCAAGTAGGAAGG + Intronic
1108627391 13:52244372-52244394 CATTTATTCCAGAAATATGTTGG + Intergenic
1108658676 13:52562095-52562117 CATTTATTCCAGAAATATGTTGG - Intergenic
1109579331 13:64305487-64305509 CATGCCTTCCAGAACTAGCAAGG - Intergenic
1109585755 13:64400920-64400942 CATGCTTTCCAAAAATCGGTTGG + Intergenic
1110885823 13:80633908-80633930 CTTTCTTTCCAAAGACAGGATGG + Intergenic
1113543112 13:111124109-111124131 GAATCTTCCCAGAAACAGGAAGG - Intronic
1114593193 14:23888205-23888227 CATTCTTCACAGAAATAGAAAGG + Intergenic
1114791554 14:25665052-25665074 CATTCTTTCCATCAAGAGGTGGG - Intergenic
1115429910 14:33304791-33304813 AAATATTTCCAAAAATAGGAAGG - Intronic
1115519035 14:34214434-34214456 CAATATTTCCAGAAACATGAGGG + Intronic
1115585155 14:34803896-34803918 CATTCTTGCCAGAAATGGTGTGG + Intronic
1116143351 14:41030614-41030636 CATTGTTTACAGATATAGGTTGG - Intergenic
1117409204 14:55435218-55435240 AATTATTTCCAGAAATTTGATGG + Intronic
1118028128 14:61791549-61791571 GATTCTATCAAGAAATAGGCCGG + Intronic
1118566872 14:67151098-67151120 AATACCTTACAGAAATAGGAAGG + Intronic
1118788847 14:69070130-69070152 GCTTCTTTCCATAAATAAGAAGG + Intronic
1119960065 14:78845546-78845568 CATTCTTTCTATAAGCAGGAAGG - Intronic
1120978063 14:90266910-90266932 AAGACTTTCCAGAAATGGGATGG - Intronic
1121073564 14:91047480-91047502 CATTCTTTGTAGAAGTAGAATGG - Intronic
1130074784 15:80679321-80679343 TATTCATTCCAGAAAGAGGTGGG + Intergenic
1130245887 15:82248303-82248325 TATTCTTTCCAGAATGAGGCTGG - Intronic
1130454809 15:84095073-84095095 TATTCTTTCCAGAATGAGGCTGG + Intergenic
1132079920 15:98854975-98854997 CAGCCATTCCAGAACTAGGAAGG - Intronic
1132173224 15:99685212-99685234 CATTCTTCACAGAACTAGGGGGG - Intronic
1132593340 16:736261-736283 CATTCTTTAAAAAAATAGGTAGG - Exonic
1134829918 16:17314614-17314636 CTTTCTTTCCTGGAATGGGAGGG - Intronic
1135266146 16:21027499-21027521 CATTTTTTTAAGAAGTAGGAAGG - Intronic
1135296878 16:21287400-21287422 CATTCATTCCAGAAATTCCAAGG - Intronic
1139320000 16:66106678-66106700 CATTCTATGAAGGAATAGGATGG - Intergenic
1140017458 16:71201423-71201445 CATTGTTTCCAGCAAGAGGTTGG - Intronic
1140341587 16:74170010-74170032 CTTTCTTTCCAGAAATATCCAGG + Intergenic
1144345377 17:14344919-14344941 CACTGCTTCCAGAAATAAGAGGG + Intronic
1144370956 17:14591232-14591254 AATTCTTTCTAGAAGTAAGATGG + Intergenic
1146126257 17:30233865-30233887 CATTCATTCCACAACTAGGAAGG + Intronic
1146544206 17:33724396-33724418 CATTCTTTCCAGACGTAAGTCGG - Intronic
1146986684 17:37226835-37226857 CCTTCTTTCCAAAAGTGGGAGGG - Intronic
1147856790 17:43486989-43487011 CATTCTTTCAAGAAATGTGGAGG - Intronic
1147913592 17:43873146-43873168 CCTTCTTTCCAGAGATCTGACGG - Intergenic
1148327487 17:46791686-46791708 CATTCATCACAGAAGTAGGAAGG + Intronic
1149010620 17:51853008-51853030 CATTCTATTTAGAAATAGGGGGG + Intronic
1153073821 18:1138839-1138861 CAGACATTACAGAAATAGGAAGG - Intergenic
1153743645 18:8154437-8154459 CATTCCTTCTAGAAATAAAATGG + Intronic
1153806774 18:8715436-8715458 CATTCTTTCCATGAACAGAATGG + Intronic
1155191361 18:23433690-23433712 CATTCTTTCAAACAATAGAAGGG + Intronic
1157057053 18:44242427-44242449 CATTCTTTTCAGAATCAAGATGG + Intergenic
1157260500 18:46172590-46172612 CTTTTTTTCCTGAAATAGGCTGG + Intergenic
1157874362 18:51258647-51258669 AATTCTTTCGAGAACTTGGAGGG - Intergenic
1157962910 18:52176809-52176831 TATTCTATCAAGACATAGGAAGG - Intergenic
1158531186 18:58263174-58263196 AATGGTTTCCAGAAATAGGGAGG - Intronic
1158551983 18:58444097-58444119 ATTTCTTTTCAGAATTAGGATGG + Intergenic
1159095769 18:63899782-63899804 CATTGTTTCAAGAAATAGTTTGG + Intronic
1159768881 18:72524370-72524392 CATTATAACCAGAAATAGCATGG + Intergenic
1165976188 19:39678847-39678869 CAACATTTCCAGAAATGGGATGG - Intergenic
1166615986 19:44246953-44246975 GATTATTACCAGAAATAAGAGGG - Intronic
1166829957 19:45633206-45633228 CATTCATTCCACAAATTGGCTGG + Intronic
1167009909 19:46800499-46800521 CTTTGCTTTCAGAAATAGGAAGG + Intergenic
1168690129 19:58371513-58371535 CATTGTTTCCAGAACAAAGATGG + Intronic
925069382 2:954632-954654 CATTTAATACAGAAATAGGAAGG - Intronic
925542636 2:4982167-4982189 CATGCTTGACAGAAGTAGGAAGG - Intergenic
925977855 2:9153476-9153498 CATTCTTTCCAGGAAGCGGTTGG - Intergenic
926233029 2:11019175-11019197 CATTCATTCCACAAATATCAAGG + Intergenic
927932509 2:27054159-27054181 CATTCTGTACAGAAAAAAGACGG - Intronic
929320701 2:40540548-40540570 CATGATTTCCAAAAATAAGAAGG - Intronic
933471948 2:82736651-82736673 CATTGTGTCAAGAAATATGAAGG - Intergenic
933593590 2:84260527-84260549 TCTTCTTTGCAGAAATAGAAAGG - Intergenic
935736639 2:106111632-106111654 CATCCTTGCCTGAAAAAGGAGGG + Intronic
936852340 2:116916050-116916072 CATTCCCTTCAGATATAGGAAGG - Intergenic
936869381 2:117116252-117116274 GATGATTTCCAGAAATTGGATGG - Intergenic
936956389 2:118026783-118026805 CATTCTATTCCTAAATAGGATGG - Intergenic
937148962 2:119672723-119672745 CAGTCTTTCCAGGATTAGTAAGG + Intergenic
939454052 2:142410211-142410233 CAGTCTCTCCAGAATTAGAAAGG + Intergenic
943214479 2:185013000-185013022 CTGTCCTTCCTGAAATAGGAAGG - Intergenic
944155913 2:196607613-196607635 CATTCTTCCCCTAAATGGGAAGG - Intergenic
944519520 2:200550321-200550343 CATTCTTCACAGAAATAAGGGGG + Intronic
945010491 2:205457029-205457051 AATCCTTTCCAGAAAAAGAAGGG - Intronic
945130225 2:206563208-206563230 CATATTTTCAAAAAATAGGAAGG - Intronic
946042713 2:216796208-216796230 CATTTCTTCCAGAGATACGAAGG + Intergenic
946463116 2:219887661-219887683 AATTCTTCCCAGAAATTGCAAGG - Intergenic
1170723923 20:18908794-18908816 CTTTCTATCCAGACAGAGGAAGG - Intergenic
1172425083 20:34850549-34850571 GATTCTCTCCAGAACTGGGAAGG + Intronic
1173432081 20:42997265-42997287 TAACCTTTCCACAAATAGGATGG + Intronic
1174125375 20:48300651-48300673 CAATCTTTTAAGAAATAGGAAGG + Intergenic
1174910214 20:54600103-54600125 CATTCCTTCCAGAAGGAAGATGG + Intronic
1176254507 20:64144635-64144657 CATTCTCTCCAGAGCTAGCAGGG - Intergenic
1176892450 21:14334247-14334269 TACTCGTTCCAGAGATAGGAAGG + Intergenic
1177104275 21:16935131-16935153 CATTATCTACAGAAATAGTAGGG + Intergenic
1178428672 21:32500031-32500053 AATTCTTTCCAGATTTACGATGG + Intronic
1178886306 21:36487426-36487448 GATTATTTCAAGAAATGGGAGGG - Intronic
1181757944 22:25038748-25038770 GTTTCTTTCCAGCAAAAGGAGGG + Exonic
1183838156 22:40474611-40474633 CATTCATTCAAGAAATATGAGGG + Intronic
1184429776 22:44435378-44435400 CATCTTTCCCAGAAATGGGATGG + Intergenic
949747790 3:7314969-7314991 CAATCTTTGCAGAAATAGTATGG - Intronic
949914633 3:8949957-8949979 CAGTCCTTCCAGGAGTAGGAGGG + Intronic
951072762 3:18351539-18351561 GATTCTGTCCAGAAAGAGGAGGG - Intronic
951502689 3:23407247-23407269 TATTCTTTCCAGAAAAAAAATGG - Intronic
951551984 3:23883320-23883342 CATTTTATCGAGAAATAGGTGGG + Intronic
951607069 3:24447436-24447458 CCTTCTTTGCAGTAATGGGAGGG + Intronic
954480851 3:50799232-50799254 CATTCTTAACAGAAATAAGGGGG - Intronic
954608276 3:51930408-51930430 CCTTCTTTCCACAAACAGGAAGG - Intergenic
955646386 3:61142145-61142167 CATGCTGTGCTGAAATAGGATGG + Intronic
955788204 3:62561930-62561952 CATTCTTTCAACAAATACGTAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956742677 3:72287361-72287383 CATCCTGTCCAGAGATAGGGAGG + Intergenic
957047591 3:75388259-75388281 AATTCTTTCCAGATTTACGATGG - Intergenic
957509090 3:81164556-81164578 CATTCATGGCAAAAATAGGAGGG + Intergenic
961879665 3:130052383-130052405 AATTCTTTCCAGATTTACGATGG - Intergenic
962858005 3:139367257-139367279 TTTTTTTTCTAGAAATAGGAAGG - Intronic
963067607 3:141275663-141275685 CTTTCTTTCCAGTAGTTGGAAGG - Intronic
964378313 3:156071311-156071333 CAATCTTTCCACAGACAGGAAGG - Intronic
965353606 3:167646268-167646290 CATTCTTTACAGTCCTAGGAAGG + Intronic
965986719 3:174762564-174762586 CCTTCTTTCCATAAATAGCTGGG - Intronic
966223508 3:177573459-177573481 CATTCTTTCCGGAAATAAATGGG + Intergenic
966724613 3:183098568-183098590 CAATCTTTCCAGAATGATGAAGG + Intronic
966772066 3:183512878-183512900 CTTTCTTCCCTGAAATTGGATGG - Intronic
968991872 4:3919493-3919515 AATTCTTTCCAGATTTACGATGG - Intergenic
969533767 4:7743448-7743470 CATTCTTTCCAGAAATGGCTTGG - Intergenic
969823469 4:9738187-9738209 AATTCTTTCCAGATTTACGATGG + Intergenic
972476737 4:39457702-39457724 TATTCTTTCCAGAAATATGCAGG + Intronic
972773974 4:42224469-42224491 CATTCTTGCCAGGAATACCACGG + Intergenic
973946740 4:55964548-55964570 CATAGTATCCAGAAATAGGGTGG + Intronic
974558930 4:63492343-63492365 CATTCTTTCCACCACTAAGAAGG + Intergenic
974907977 4:68080584-68080606 GATTCTTCCCAGAAATTAGAGGG - Intronic
974925422 4:68292148-68292170 AATTGGTACCAGAAATAGGATGG - Intergenic
975353864 4:73376438-73376460 AATTCTTTCCAGGAATAAAATGG - Intergenic
975506029 4:75138705-75138727 AGTTCTTTCCAGAACAAGGAAGG - Intergenic
976512007 4:85921919-85921941 CATTGTTTCCACAAATGGGGTGG - Intronic
976928902 4:90538106-90538128 CATTCTTTTCAGATATAAGGTGG + Intronic
977110440 4:92945963-92945985 CATGCCTTCCAGAAATATGTTGG + Intronic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
979220461 4:118217594-118217616 CACTCTTTACAGAAAAAGTAAGG - Intronic
979250667 4:118563868-118563890 CATTTTTTCCAGAAATCTGGGGG - Intergenic
979848811 4:125551113-125551135 TATTCTGTCCAGAATTAAGATGG + Intergenic
979861293 4:125696850-125696872 AATTCTTTCTAAAAATAAGATGG - Intergenic
980633265 4:135466299-135466321 TATTGTTTCCAGGAAAAGGAGGG + Intergenic
981180097 4:141731469-141731491 CACTCTTTCCACCAATAAGATGG - Intronic
981347363 4:143691842-143691864 CATTCTTTTCAAAAACAGAAAGG + Intronic
982586835 4:157252311-157252333 CATTCCTTCAAGTAAAAGGATGG - Intronic
984945081 4:184964609-184964631 CTTCCTTTTCAGAAATAGTAAGG + Intergenic
986148505 5:5104388-5104410 CAATCTTTCCAGAGTTAGCAAGG - Intergenic
986377713 5:7149209-7149231 CATCCTATCCAGCACTAGGAAGG + Intergenic
986604711 5:9509944-9509966 TATTATTTCAAGTAATAGGAGGG + Intronic
987629646 5:20452446-20452468 CATTCTTTTCAGGAACATGATGG + Intronic
987681020 5:21136151-21136173 CATTTTTCCCAGAAACAGGATGG - Intergenic
988394284 5:30677854-30677876 CATTCTTTACAGGAATATGTAGG - Intergenic
988519670 5:31934271-31934293 CACGCTTTCCTGAACTAGGAAGG + Intronic
988958972 5:36350013-36350035 CTTACTTTCCAGAAATAGGTAGG + Intergenic
989007580 5:36831913-36831935 CATCCTTTCTTGAAATATGAAGG - Intergenic
990064029 5:51689932-51689954 CATTCATTACAGAAAGATGATGG - Intergenic
990114606 5:52372857-52372879 AATTCTTGCAAGAAATAGCATGG + Intergenic
990483134 5:56230653-56230675 CATGCTTTTAAGAAAGAGGAAGG + Intronic
991260628 5:64663918-64663940 TATTCTTTCTAGGAATAGAATGG + Intergenic
995552944 5:113298478-113298500 AATTCTTTCCATAAATTTGATGG + Intronic
1001563435 5:172684680-172684702 CATTCATGCCACAAATAGGCAGG + Intronic
1002317949 5:178356558-178356580 CCTTCTTCCCAGAAAGAGAAAGG + Intronic
1004770777 6:18778662-18778684 CATTCTTTCCAAAAGGAAGATGG - Intergenic
1007122142 6:39391246-39391268 CACTGGTTCCAGAAGTAGGAAGG + Intronic
1010697211 6:78991435-78991457 CACTCTTTCCAGAGACAGGGAGG + Intronic
1012431181 6:99165084-99165106 CTCACTTTCCAGAAATGGGAAGG - Intergenic
1013410225 6:109877158-109877180 CAATCTGTCCTGAAAAAGGAAGG - Intergenic
1017587652 6:155945103-155945125 CATTCTGATCAGAGATAGGATGG - Intergenic
1018486758 6:164248484-164248506 GAATGTTTCCAGAAAAAGGAAGG + Intergenic
1019220372 6:170468402-170468424 CATTCTCCCCAGAAGAAGGAGGG - Intergenic
1019406717 7:887824-887846 CATTCTTTCCAGCGCTGGGATGG + Intronic
1020314684 7:6897062-6897084 AATTCTTTCCAGATTTACGATGG - Intergenic
1020730901 7:11878777-11878799 CATTCTTCAAAGAAATAGAAAGG + Intergenic
1021404673 7:20251172-20251194 CATTCTAGCCAGAAACAGGTTGG + Intergenic
1022247755 7:28576871-28576893 TATCTTTTCCAAAAATAGGAGGG - Intronic
1022977973 7:35575887-35575909 CCTTCATTCCAGAAATAGCCAGG + Intergenic
1023053807 7:36275808-36275830 TATTCTTTTCAGAAAGAGGGAGG + Intronic
1023573826 7:41603271-41603293 CCTTCTCTCCAGAAATTGCATGG + Intergenic
1026158167 7:67845841-67845863 CATTCTTTGCAGCAAGAAGAAGG - Intergenic
1026705795 7:72691907-72691929 CATTCTTTTAAGAAACAGGCTGG + Intronic
1027434399 7:78149305-78149327 CATGCTTTCCAGATATAAGACGG - Intronic
1027730547 7:81866820-81866842 CATTCATTCCAGAATGAAGAGGG + Intergenic
1028669060 7:93380200-93380222 CAGTTTCTCCAAAAATAGGAAGG - Intergenic
1029942275 7:104493024-104493046 TATTCTTTTCAGAAATTTGAAGG - Intronic
1030854495 7:114536352-114536374 CATTCTTTCCAGAGATACCCTGG - Intronic
1031072981 7:117182910-117182932 CAATCTTTCAAGAATTAAGATGG - Intronic
1031378156 7:121052487-121052509 CATCTTTTCCTGAAATAAGAAGG + Intronic
1031443135 7:121817718-121817740 GATTTTTTTCAGAAATAGAAAGG + Intergenic
1033284790 7:140031818-140031840 AATGACTTCCAGAAATAGGAGGG + Intronic
1034014218 7:147564954-147564976 CATTCTTTCCAGGAAAAGGAAGG - Intronic
1034611186 7:152370465-152370487 AATCCCTTCCAGAAAAAGGAGGG + Intronic
1036208350 8:6821883-6821905 CAGCCCTTCTAGAAATAGGATGG - Exonic
1037919868 8:22798229-22798251 CATTCTCTCCAGAATTAGCAAGG - Intronic
1038406157 8:27324531-27324553 GTTTCTTTTCAGAAATGGGAAGG + Intronic
1040746791 8:50652919-50652941 CATTATTTCTAGAAATAAAAAGG - Intronic
1040855464 8:51944216-51944238 CTTTCTTTCCTGCAATAGCATGG + Intergenic
1041634943 8:60132473-60132495 CACTGTTTCCAGTAATAGGATGG - Intergenic
1042653797 8:71072584-71072606 CATTTTTTACAAAAATAGGAGGG - Intergenic
1042686324 8:71444877-71444899 CATAGTTTCCACAAATAGGTTGG - Intronic
1042958339 8:74276080-74276102 CATTATTTCTAGGAATAAGAGGG + Intronic
1043801413 8:84615423-84615445 CATTCTTTTCTGGAATAAGATGG - Intronic
1044869740 8:96607127-96607149 CAATCTTTCCATGAATGGGAGGG - Intronic
1046002769 8:108441792-108441814 CAGTATTTCTAGACATAGGATGG + Intergenic
1046049451 8:109004379-109004401 AATTCTTTTCAGAAATATTACGG - Intergenic
1046333531 8:112753423-112753445 CATTCTTTCCAGAAATAGGAAGG - Intronic
1046466395 8:114609461-114609483 CATTCATTCAACAAATAGGGAGG - Intergenic
1049282889 8:141759496-141759518 CATTATTTAGAGAAAGAGGAAGG + Intergenic
1050157492 9:2683030-2683052 CTTTCTTTCAAGCAATGGGAAGG + Intergenic
1050737382 9:8779484-8779506 CATTCTTTCTAATAATTGGAAGG - Intronic
1051130783 9:13857823-13857845 CATTCATTACAGAAATAACAAGG - Intergenic
1051963328 9:22794925-22794947 CATTCTTATGAGAAATTGGAAGG - Intergenic
1052102333 9:24463851-24463873 CATACTTTCCAGAAAGATGGAGG + Intergenic
1052560802 9:30080436-30080458 CAGTGTTTCAAGAAATAGGCTGG + Intergenic
1055012344 9:71580588-71580610 CATTTTTTTCAGTAATGGGATGG + Intergenic
1055803188 9:80063469-80063491 CCTTGTGTCCATAAATAGGATGG - Intergenic
1056237643 9:84611005-84611027 CATTCTTCCCATAAAGAGGTAGG - Intergenic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1056938059 9:90933018-90933040 CATTTTGTCCAGAATTTGGAAGG + Intergenic
1059866872 9:118524449-118524471 CAGTTTTTGCAGAAATAGAAAGG + Intergenic
1203582631 Un_KI270746v1:26005-26027 CTTTCTTTCAAGAAATTAGAAGG - Intergenic
1185828097 X:3272285-3272307 CATTCTTTGCAGAAAAATGCTGG + Exonic
1186096059 X:6103342-6103364 CTTTCCTTCCAGAAAATGGAGGG - Intronic
1186113646 X:6282248-6282270 GTTTCTTTCCAGAAATATTAAGG - Intergenic
1186392662 X:9176197-9176219 CATGTTTGCCACAAATAGGAAGG - Intergenic
1187216181 X:17279121-17279143 CATTCTGACCTGAAATATGAGGG + Intergenic
1188231891 X:27674327-27674349 TATTTTTACTAGAAATAGGAAGG - Intronic
1188308131 X:28584257-28584279 TTTTCTTTCCAGTAATATGATGG - Intergenic
1189339204 X:40191779-40191801 CATTCATTCAACAAATAGAAAGG - Intergenic
1190039432 X:47057853-47057875 CATTCTTCTCAGAAATGGAAGGG + Intronic
1190492038 X:50991999-50992021 AATCTTTTCAAGAAATAGGAGGG + Intergenic
1190501124 X:51079681-51079703 AATCTTTTCAAGAAATAGGAGGG - Intergenic
1190525844 X:51328849-51328871 CCTTTTTTTCAGAATTAGGAAGG - Intergenic
1190543633 X:51502813-51502835 CCTTTTTTTCAGAATTAGGAAGG + Intergenic
1190679899 X:52817010-52817032 CGTTCTTTTGAGAAATAGGTAGG + Intronic
1191086377 X:56571819-56571841 CATGGTTTCCAGAACAAGGAAGG + Intergenic
1191855586 X:65623293-65623315 AACTCTTTCAAGAAATAGAAGGG - Intronic
1191937667 X:66442565-66442587 CTCTCTTTCCAGAAAAAGAAAGG - Intergenic
1192367245 X:70484198-70484220 CATTCTTTGCAGCCATAGGATGG + Intronic
1193629709 X:83868270-83868292 GATTCTTTAGAGAAATAGCATGG - Intronic
1193883684 X:86959260-86959282 AATTGTTTCCTGAAATAAGATGG - Intergenic
1195332924 X:103820508-103820530 TAGTCCTTCCAGAAACAGGAAGG - Intergenic
1195363790 X:104108528-104108550 CCTTACTTCCACAAATAGGAAGG + Intronic
1197813300 X:130469629-130469651 CTTTCTTTCCAAAAAAAAGAAGG + Intergenic
1198006261 X:132497630-132497652 CATTCTATCCCAAAAAAGGAAGG - Intergenic
1198032024 X:132762461-132762483 GATCCTTTTCAGAAATAGGTGGG + Intronic
1198143919 X:133835450-133835472 CTTTCTGTGCAGAAAAAGGATGG - Intronic
1198604692 X:138323833-138323855 CATTCTGTCCAGGATCAGGAGGG + Intergenic
1198927636 X:141816296-141816318 CATTCAGTCCAGAAATATGATGG + Intergenic
1200950689 Y:8896605-8896627 CCTTGTTAGCAGAAATAGGAGGG + Intergenic
1201483299 Y:14464328-14464350 GTTTCTTTCCAGAAATATCAAGG + Intergenic