ID: 1046336470

View in Genome Browser
Species Human (GRCh38)
Location 8:112795246-112795268
Sequence CCAATCCCTTAGTACACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046336470_1046336474 28 Left 1046336470 8:112795246-112795268 CCCAGGGTGTACTAAGGGATTGG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1046336474 8:112795297-112795319 ATGAAAGTTTGTCCCAGTACTGG No data
1046336470_1046336473 -8 Left 1046336470 8:112795246-112795268 CCCAGGGTGTACTAAGGGATTGG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1046336473 8:112795261-112795283 GGGATTGGTCATCATGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046336470 Original CRISPR CCAATCCCTTAGTACACCCT GGG (reversed) Intronic
903322006 1:22548818-22548840 GCAATACCTTACTACACCCTAGG - Intergenic
904811020 1:33163608-33163630 CACATCCCTTGGAACACCCTAGG + Intronic
906850429 1:49243396-49243418 CCAATTCCTTATCAAACCCTGGG + Intronic
910429661 1:87148417-87148439 CCAAGCCTTTAGGACACCCAGGG - Intronic
914343893 1:146781888-146781910 CCAAGCCCTTAGTCCATCCATGG + Intergenic
921436956 1:215134746-215134768 CCAATCCCTTAGAATTTCCTGGG - Intronic
921838610 1:219804312-219804334 CCAAACCATTACTACACCCTAGG - Intronic
921948082 1:220901919-220901941 CCAAGCAGTGAGTACACCCTTGG + Intergenic
1073901720 10:108230158-108230180 CCATTCACCTAGTACACCCTAGG + Intergenic
1075397995 10:122141555-122141577 CCCATCTCTGAGAACACCCTGGG - Intronic
1079106876 11:17577453-17577475 CCAATCCCTTCCTCCACCCCAGG - Intronic
1084828220 11:71747492-71747514 CCAATCCCCTAGGTCACCGTTGG + Intergenic
1086663215 11:89447794-89447816 TCTAACCCTTACTACACCCTTGG + Intronic
1087828519 11:102793731-102793753 CCAATCCCTTTGTTGTCCCTTGG + Intronic
1088550726 11:111009956-111009978 CCCATCCCTCAATCCACCCTGGG - Intergenic
1099165620 12:79303787-79303809 TCAATTCCTTAGTACTTCCTTGG + Intronic
1112964028 13:105164973-105164995 CCCACCCCTTAATACTCCCTGGG + Intergenic
1114035490 14:18622848-18622870 CCAATCCCTTAGTCTATACTTGG - Intergenic
1114123149 14:19692174-19692196 CCAATCCCTTAGTCTATACTTGG + Intergenic
1114631992 14:24164993-24165015 CCTACCTCTTAGTACCCCCTGGG + Intronic
1120083446 14:80241514-80241536 CCAATCCCTTGGAATATCCTGGG + Intronic
1122940656 14:104979558-104979580 CCAAACTCTTAGAACTCCCTTGG - Intergenic
1126583894 15:50264630-50264652 TCCATTCCTTAGTACTCCCTGGG + Intronic
1128842670 15:70862840-70862862 CCAGTCCCTCAGTAAACTCTAGG - Intronic
1132205285 15:99982282-99982304 CCACTCCCTTAGCACTCCTTGGG + Intronic
1138146654 16:54618799-54618821 CCATTCTCTTAGTACACACTTGG + Intergenic
1139510959 16:67428382-67428404 CCAAACCCTTAGCACGCCCCAGG - Intergenic
1139990100 16:70933447-70933469 CCAAGCCCTTAGTCCATCCATGG - Intronic
1145408213 17:22629269-22629291 CCTTTCCCTTTCTACACCCTGGG - Intergenic
1150274219 17:63885585-63885607 CAAATCCATAAGAACACCCTAGG + Intergenic
1150276366 17:63900412-63900434 CAAATCCATAAGAACACCCTAGG + Intergenic
1153353670 18:4110428-4110450 CCATTCCATGAGTACACACTGGG - Intronic
1165771913 19:38385179-38385201 CCAATCCCTAAGTGGACTCTTGG - Intronic
925420615 2:3707722-3707744 CCAGTCCCTGAGACCACCCTTGG + Intronic
928386366 2:30871892-30871914 CCAAGCCCTTAAAACAGCCTGGG - Intergenic
938274911 2:130010115-130010137 CCAATCCCTTAGTCTATACTTGG + Intergenic
1172848964 20:37947014-37947036 GCCATCCCATACTACACCCTGGG + Intergenic
1176812127 21:13552606-13552628 CCAAGACCTTAGTCGACCCTGGG - Intergenic
1177279765 21:18966151-18966173 CCAATCCCTTATTCCACACGGGG - Intergenic
1178357611 21:31921710-31921732 TCCATGCCTTAGTTCACCCTGGG + Intronic
1180459611 22:15549902-15549924 CCAATCCCTTAGTCTATACTTGG - Intergenic
1181764282 22:25080006-25080028 CCAATCCATGAGCACATCCTGGG - Intronic
957839623 3:85651733-85651755 CCAAACTCTGACTACACCCTTGG + Intronic
962649352 3:137472872-137472894 CCAACCCCTGAGTTCCCCCTAGG - Intergenic
981748868 4:148074653-148074675 CCCATTCCTCAGTACATCCTGGG - Intergenic
984527964 4:180880083-180880105 CCAATACCTTAATACACATTAGG - Intergenic
991636652 5:68712689-68712711 CCAATTCCTTGGGACTCCCTTGG + Intergenic
996540311 5:124624667-124624689 CCAGTCCCTTCTTTCACCCTGGG + Intergenic
999441662 5:151605991-151606013 CCAACCTCTTACTCCACCCTGGG + Intergenic
1001160569 5:169309025-169309047 CCATTCTCTCAGGACACCCTGGG - Intergenic
1003161936 6:3643613-3643635 CCAACCCCATGGAACACCCTGGG - Intergenic
1005927441 6:30455221-30455243 GCAATCCATCAGTGCACCCTAGG + Intergenic
1007165968 6:39829382-39829404 ACACTCCTTTGGTACACCCTGGG - Intronic
1008990502 6:57596032-57596054 CTAATCCCTTGGAACTCCCTGGG - Intronic
1010637053 6:78272962-78272984 CCATTCCTTTTGTATACCCTTGG + Intergenic
1025142225 7:56475699-56475721 CCAATCCTCTAGTACATGCTGGG + Intergenic
1028311964 7:89349772-89349794 ACATTCCCTTAGAAAACCCTGGG - Intergenic
1034720535 7:153288302-153288324 CAAATCCCTTAATACAGCCAGGG - Intergenic
1038235117 8:25745516-25745538 GCAATCCTTTAGAACAACCTGGG - Intergenic
1038945780 8:32358187-32358209 CCAATTCCCTAGTACTCCCAAGG - Intronic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1044211702 8:89558350-89558372 CCAATTCATCATTACACCCTGGG - Intergenic
1045298862 8:100893641-100893663 CCTATCCCCTTTTACACCCTGGG - Intergenic
1045790609 8:105978778-105978800 CCAATCCACAAGTCCACCCTAGG + Intergenic
1046336470 8:112795246-112795268 CCAATCCCTTAGTACACCCTGGG - Intronic
1051411866 9:16798007-16798029 GCAATCCATCAGTTCACCCTGGG + Intronic
1053640107 9:40065401-40065423 CCAAACCCTTAGTCAATCCTAGG + Intergenic
1053766026 9:41400081-41400103 CCAAACCCTTAGTCAATCCTAGG - Intergenic
1054544640 9:66311234-66311256 CCAAACCCTTAGTCAATCCTAGG - Intergenic
1057076431 9:92140620-92140642 CCACTCGCTGAGTGCACCCTGGG - Intergenic
1057167641 9:92941227-92941249 CCCATCCCCTACCACACCCTGGG - Intergenic
1189170481 X:38904943-38904965 CAAATCCCTCAGTGCAGCCTAGG + Intergenic
1196989412 X:121311635-121311657 TCAGATCCTTAGTACACCCTCGG - Intergenic
1199529838 X:148833786-148833808 CCAATTACTTACTACACACTAGG + Intronic