ID: 1046336688

View in Genome Browser
Species Human (GRCh38)
Location 8:112798980-112799002
Sequence CAACTTGTATTTTACATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3208
Summary {0: 1, 1: 1, 2: 80, 3: 913, 4: 2213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046336688 Original CRISPR CAACTTGTATTTTACATGCA GGG (reversed) Intronic
Too many off-targets to display for this crispr