ID: 1046343067

View in Genome Browser
Species Human (GRCh38)
Location 8:112884088-112884110
Sequence GTCCAGGTTAAAACACCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046343067 Original CRISPR GTCCAGGTTAAAACACCCTG TGG (reversed) Intronic
901798337 1:11692920-11692942 GTGCTGGTTCACACACCCTGTGG + Intronic
911886426 1:103306010-103306032 GTCCATTTTAAAACATTCTGGGG - Intergenic
913153338 1:116067606-116067628 GTCCAGGGAAAAGCACCCAGAGG + Exonic
915274330 1:154777537-154777559 TTCCAGGTTGAACCACCCTTTGG - Intronic
915489011 1:156241322-156241344 CTCCAGTGTTAAACACCCTGGGG - Intronic
920674699 1:208030873-208030895 GTCCAGGTTCAAAACCCATGAGG + Intronic
922466463 1:225848311-225848333 ATGCAGGTTAAAATACCCAGGGG + Intronic
1070943429 10:80367560-80367582 GTCCAGGATAAAACCCCTTGTGG - Exonic
1074324321 10:112433418-112433440 TTCCATGCTAAAACAACCTGTGG - Intronic
1077578487 11:3402268-3402290 GTGCAGGTCCACACACCCTGAGG + Intergenic
1085058583 11:73423974-73423996 GTCCAGGTTCATATATCCTGAGG + Intronic
1087634500 11:100687417-100687439 GTCCAGATGACAACAACCTGAGG + Intergenic
1097556194 12:61140566-61140588 GTGCAGGTTAACACACTCTCTGG - Intergenic
1102441487 12:112967264-112967286 TTCCACCTAAAAACACCCTGTGG + Intronic
1108167216 13:47706393-47706415 GTCAAGGTAGGAACACCCTGTGG - Intergenic
1108648513 13:52453259-52453281 GTCCTGGCAAAAACATCCTGGGG - Intergenic
1109166015 13:59036443-59036465 ATCCAGGCTAAAACAAACTGAGG + Intergenic
1111092147 13:83461932-83461954 GTCCTGGTTACCACTCCCTGGGG - Intergenic
1112738020 13:102443082-102443104 GGCCAGCTAAAAACCCCCTGTGG - Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1128543250 15:68551320-68551342 GTCCAGGTAACAACCCCCAGGGG + Intergenic
1129362022 15:75030024-75030046 GCCCAGGCTAAAAGGCCCTGGGG - Intronic
1129648776 15:77464234-77464256 ATTCAGGTTAAATCACCCAGAGG + Exonic
1131015289 15:89052901-89052923 GTCTAGTCTAAGACACCCTGAGG - Intergenic
1133014118 16:2930966-2930988 GTACATTTTAAAAGACCCTGTGG - Intronic
1133174321 16:4002533-4002555 GTCCATGTAGAAACACCCAGTGG + Intronic
1133744050 16:8674289-8674311 ATCCAGGTTAAATCAACCTATGG + Intergenic
1141192262 16:81833338-81833360 GTCCAGGAAAAAGGACCCTGGGG - Intronic
1143119676 17:4599002-4599024 GTGCAGGTTACAAGACCCTCTGG - Intronic
1143643464 17:8213751-8213773 GTACAGGTAAAAACAACCTGAGG - Intergenic
1147001461 17:37365805-37365827 GTCCATGTGAAAACATCGTGGGG - Intronic
1148894749 17:50833208-50833230 GTGCAGGTGAAAACACTGTGTGG + Intergenic
1150996694 17:70326307-70326329 GGCCAGGTCAAAACAACATGGGG + Intergenic
1158576174 18:58640446-58640468 GTCCAGGTTCACACATCTTGGGG - Intergenic
1162261528 19:9538397-9538419 GCACAGATGAAAACACCCTGCGG + Intronic
1165112742 19:33511744-33511766 CTCCAGGTTTAAATACTCTGCGG - Intronic
932593991 2:73083031-73083053 GTCCAGGTGGAAATATCCTGGGG + Intronic
938774731 2:134531489-134531511 GCACAGGTTAAAACACCCTGGGG - Intronic
945135094 2:206618344-206618366 GTCCAGGAGAAAACACAATGGGG - Exonic
947355753 2:229293533-229293555 CTCCAAGATCAAACACCCTGGGG - Intergenic
947931367 2:233967925-233967947 GTCCAGGTTCACAGATCCTGAGG + Intronic
1169415090 20:5409307-5409329 GCACAGGTAAAAACAGCCTGGGG - Intergenic
1178245814 21:30951044-30951066 GTGCAGGTAAAAACAATCTGGGG - Intergenic
1184613117 22:45618619-45618641 CTCCCAGTTAGAACACCCTGTGG - Intergenic
949357469 3:3197297-3197319 GTCCAGGTTAAAAGACCCTGTGG + Intergenic
956511400 3:69997377-69997399 CTCCAGATTAAAACTCCTTGAGG - Intergenic
956608695 3:71099843-71099865 GTCCAGTGTAAAAGATCCTGTGG + Intronic
960619763 3:119626607-119626629 GTCCTGTTTAAAACTCCCAGTGG - Intronic
961526061 3:127498406-127498428 GTACATGTTAAAACCCCCTGAGG + Intergenic
964385805 3:156146420-156146442 GTCAAGGTTAAAATACACTGAGG + Intronic
964974006 3:162598589-162598611 GTCCAGGGTAAAACCCCTCGTGG + Intergenic
966666540 3:182478022-182478044 GTGCAGCTGAAAACATCCTGGGG - Intergenic
967093156 3:186152538-186152560 GTTCAGGGTACAACACACTGTGG + Intronic
969819659 4:9710276-9710298 GTGCAGGTCCACACACCCTGAGG - Intergenic
973665810 4:53158096-53158118 GCCCAGGTTAAAACCTCCAGTGG + Intronic
979877682 4:125913735-125913757 GTCCAAGTTTACACACTCTGAGG + Intergenic
982636052 4:157898056-157898078 GTCAAGGTAAAAACTCCCTTAGG - Intergenic
984506146 4:180621457-180621479 TTCCAGGTTAAAGAAACCTGTGG + Intergenic
985035867 4:185839376-185839398 GTCCTGGGTAAAATAGCCTGAGG - Intronic
987873734 5:23652621-23652643 GTCCAGATTAAAAAATCCCGTGG + Intergenic
997415549 5:133725581-133725603 GTCCAGGTCAACTCACCCAGAGG - Intergenic
1002108141 5:176890438-176890460 GTATAGGTTAAAAAACACTGAGG - Intronic
1007217797 6:40254026-40254048 GCCTAGGCTAAAAGACCCTGAGG + Intergenic
1007481004 6:42149845-42149867 GGCCAGGTAAAAACATCCCGTGG + Intergenic
1010514092 6:76752722-76752744 CTGCAGGCTAAAACACTCTGAGG + Intergenic
1012312934 6:97750614-97750636 GTCCTGGCTATAACACCCAGAGG - Intergenic
1014949599 6:127539178-127539200 GTACAGTTTGAAAAACCCTGGGG + Intronic
1015376186 6:132512990-132513012 GTCCAGGTAAGAGGACCCTGGGG - Exonic
1019483407 7:1276549-1276571 GTGCAGGCTCAAACACGCTGAGG + Intergenic
1021274219 7:18629375-18629397 GTCCAGGTTAAAACAGAAAGTGG + Exonic
1022082250 7:27034229-27034251 GGCCATGTGAAAACACTCTGGGG - Intergenic
1024229462 7:47353232-47353254 GTCCAAGCTGAGACACCCTGCGG + Intronic
1038123661 8:24646553-24646575 GAACAGGTTAAAAAACTCTGGGG + Intergenic
1042696261 8:71557381-71557403 GTCTAGGTGAAAACTCCCTTCGG - Intronic
1046343067 8:112884088-112884110 GTCCAGGTTAAAACACCCTGTGG - Intronic
1047588707 8:126303056-126303078 GTCCAACTTAAAACAGCCTTAGG - Intergenic
1052825626 9:33172167-33172189 GTCCAGCTGAAATCTCCCTGTGG + Intergenic
1057775161 9:98001945-98001967 GTCCAGAGTCACACACCCTGTGG + Intronic
1186874952 X:13807633-13807655 GTCCAGGTAAATACAGCCTTGGG - Exonic
1189954550 X:46263914-46263936 GGCCAGGTAAAAAGATCCTGTGG + Intergenic
1198550776 X:137742980-137743002 CTCCAGGTTAAAAATCCCTGTGG - Intergenic