ID: 1046344633

View in Genome Browser
Species Human (GRCh38)
Location 8:112906458-112906480
Sequence GAGACGTTTTTTTGGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1238
Summary {0: 1, 1: 0, 2: 10, 3: 183, 4: 1044}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046344633_1046344637 -7 Left 1046344633 8:112906458-112906480 CCAACCAACCAAAAAAACGTCTC 0: 1
1: 0
2: 10
3: 183
4: 1044
Right 1046344637 8:112906474-112906496 ACGTCTCTAATAATTGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046344633 Original CRISPR GAGACGTTTTTTTGGTTGGT TGG (reversed) Intronic
900039366 1:444749-444771 TGGACTGTTTTTTGGTTGGTAGG - Intergenic
900060798 1:679725-679747 TGGACTGTTTTTTGGTTGGTAGG - Intergenic
900277974 1:1845153-1845175 TAGACCTTTTTTTGGTTGGTTGG - Intronic
900840493 1:5045345-5045367 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
901864810 1:12098088-12098110 GTTATGTTTTTTTGGTGGGTTGG + Intronic
902660560 1:17898874-17898896 CAGGACTTTTTTTGGTTGGTCGG - Intergenic
903396253 1:23003866-23003888 GAGATGTTCCTTGGGTTGGTTGG + Intergenic
903895202 1:26598443-26598465 GAGATGTTTGTTTGTTTGTTTGG + Intergenic
904012474 1:27397807-27397829 GAGGGATTTTTTTGGTTGGGGGG - Intergenic
904711352 1:32432859-32432881 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
905437897 1:37971368-37971390 TGGACTTTTTTTTGGTTGGTAGG - Intronic
905499497 1:38425634-38425656 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
906080624 1:43086031-43086053 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
906744829 1:48214280-48214302 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
907520991 1:55023278-55023300 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
907979239 1:59464883-59464905 TGAACTTTTTTTTGGTTGGTAGG - Intronic
908323566 1:63001688-63001710 GATGGGTTTTCTTGGTTGGTTGG + Intergenic
908451046 1:64255278-64255300 GAGCTTTTTTTTTGGTTGGTAGG - Intronic
908851143 1:68377332-68377354 GAGAGGTTTCTTTGGCTAGTTGG + Intergenic
908852050 1:68386547-68386569 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
908929269 1:69297442-69297464 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
909014495 1:70368169-70368191 GAGATGTTCTTTGGGCTGGTTGG - Intronic
909051189 1:70770315-70770337 GGGCTTTTTTTTTGGTTGGTAGG + Intergenic
909222912 1:72984909-72984931 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
909223954 1:72993021-72993043 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
909230602 1:73084244-73084266 TTGACTTTTTTTTGGTTGGTGGG + Intergenic
909431749 1:75596306-75596328 TCAACTTTTTTTTGGTTGGTAGG - Intronic
909453614 1:75826093-75826115 CTGAGCTTTTTTTGGTTGGTGGG + Intronic
909518329 1:76537880-76537902 TGGTCTTTTTTTTGGTTGGTAGG - Intronic
909536035 1:76737239-76737261 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
909682975 1:78313530-78313552 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
909793266 1:79701500-79701522 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
909909650 1:81245843-81245865 GAGATGTTTCTTTGGCTGGTCGG - Intergenic
910144145 1:84058786-84058808 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
910454122 1:87377303-87377325 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
910513081 1:88027304-88027326 CAGAACTTTTTCTGGTTGGTGGG + Intergenic
910699246 1:90054627-90054649 GAGACTTCTTTGTGCTTGGTAGG - Intergenic
910748373 1:90599362-90599384 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
910827500 1:91425007-91425029 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
911070860 1:93830851-93830873 GAGATGTTTCTTGGGCTGGTTGG - Intronic
911243087 1:95486585-95486607 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
911310423 1:96285945-96285967 TGGGCATTTTTTTGGTTGGTAGG + Intergenic
911373916 1:97027245-97027267 GAGGTTTTTTTTTGGTTGGTAGG - Intergenic
911424075 1:97684857-97684879 CTGAGCTTTTTTTGGTTGGTAGG - Intronic
911582860 1:99654777-99654799 TAGATTTTTGTTTGGTTGGTTGG + Intronic
911614404 1:99992727-99992749 GAGACCTTTTTTCTGTTTGTTGG + Intronic
911718236 1:101160235-101160257 GACTTTTTTTTTTGGTTGGTAGG - Intergenic
911760008 1:101602963-101602985 GAGACGTTCCTTGGGCTGGTCGG + Intergenic
912150830 1:106856725-106856747 GGGCGTTTTTTTTGGTTGGTAGG - Intergenic
912300941 1:108516411-108516433 TGGCCTTTTTTTTGGTTGGTAGG + Intergenic
912586308 1:110769826-110769848 CAGAGGTTTTTTTTTTTGGTGGG + Intergenic
912857342 1:113181700-113181722 CAGGGCTTTTTTTGGTTGGTAGG - Intergenic
912967054 1:114245316-114245338 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
913271310 1:117096353-117096375 GAGAATTCTTTTTGTTTGGTTGG + Intronic
913593455 1:120351438-120351460 GAAACAATTTTTTGTTTGGTTGG - Intergenic
913995667 1:143650446-143650468 GAGACTTTTTGGTGGTTGGTCGG + Intergenic
914093800 1:144527548-144527570 GAAACAATTTTTTGTTTGGTTGG + Intergenic
914304725 1:146406356-146406378 GAAACAATTTTTTGTTTGGTTGG - Intergenic
914597330 1:149166473-149166495 GAAACAATTTTTTGTTTGGTTGG + Intergenic
914863998 1:151410349-151410371 GAGCCATTTTGTTGGTTGGTAGG - Intronic
915382850 1:155458740-155458762 AAGACGGTTGGTTGGTTGGTTGG - Intronic
915688774 1:157665121-157665143 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
916182868 1:162102572-162102594 CTGAGCTTTTTTTGGTTGGTAGG + Intronic
916363840 1:164000981-164001003 CAGGGCTTTTTTTGGTTGGTAGG - Intergenic
917158359 1:172028920-172028942 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
917172999 1:172198542-172198564 GGGCTTTTTTTTTGGTTGGTAGG + Intronic
917269947 1:173261841-173261863 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
917324206 1:173815198-173815220 GTAGCCTTTTTTTGGTTGGTAGG - Intronic
917408092 1:174730544-174730566 AAGACCTTTTTTTGGTGAGTTGG + Intronic
918100891 1:181373264-181373286 CAGGGGTTTTTCTGGTTGGTAGG + Intergenic
918159591 1:181885722-181885744 TGGACTTTTTTTTGGTTGATAGG - Intergenic
918238740 1:182603811-182603833 GAGATTTTTTTTTTTTTGGTGGG - Intronic
918346711 1:183613751-183613773 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
918568001 1:185953632-185953654 GAGATGTTTCTTGGGCTGGTCGG + Intronic
918603805 1:186396631-186396653 GAGGTATTTTTTTGGTTGGTTGG - Intronic
918714683 1:187770634-187770656 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
918975091 1:191473896-191473918 GTGGGCTTTTTTTGGTTGGTAGG - Intergenic
919012094 1:191977717-191977739 GAGAAGTTTTCTGGGTTGGGAGG + Intergenic
919306063 1:195839056-195839078 GAGGTGTTTGGTTGGTTGGTTGG - Intergenic
919476079 1:198035166-198035188 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
919603469 1:199650827-199650849 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
920889681 1:209972014-209972036 CAGGGCTTTTTTTGGTTGGTAGG + Intronic
921004468 1:211079329-211079351 GTGGAGTTTTTTTGGTTGGTAGG - Intronic
921104576 1:211963351-211963373 GGGCTTTTTTTTTGGTTGGTAGG - Intronic
921336823 1:214095878-214095900 CAGGGCTTTTTTTGGTTGGTAGG - Intergenic
921401064 1:214724322-214724344 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
921460068 1:215415103-215415125 GAGAAGTTTCTTGGGCTGGTCGG + Intergenic
921461244 1:215429782-215429804 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
921519864 1:216146161-216146183 GAGATGTTTCTTGGGCTGGTCGG - Intronic
921732539 1:218594170-218594192 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
921733395 1:218599503-218599525 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
921942816 1:220860742-220860764 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
921962545 1:221050935-221050957 TGGTCTTTTTTTTGGTTGGTAGG - Intergenic
922441399 1:225657869-225657891 GAGCCTTTTTTTTGGGTGATGGG - Intergenic
922515728 1:226206940-226206962 GAGCCGTGTTTGTGGATGGTTGG - Intergenic
922552033 1:226501890-226501912 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
922877016 1:228947965-228947987 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
923074922 1:230601756-230601778 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
923279975 1:232434361-232434383 GAGGCGCTTTGTTTGTTGGTTGG - Intronic
923408949 1:233688717-233688739 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
923771013 1:236937362-236937384 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
924180339 1:241434399-241434421 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
924867642 1:248002979-248003001 GGGCCTTTTCTTTGGTTGGTAGG + Intronic
924883996 1:248192463-248192485 TGGACTTTTTTTTGGATGGTAGG - Intergenic
1063338315 10:5238311-5238333 TGGTCTTTTTTTTGGTTGGTAGG - Intergenic
1063340184 10:5255653-5255675 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1063362819 10:5471287-5471309 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1063509930 10:6634961-6634983 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1063527982 10:6802371-6802393 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1063941043 10:11129507-11129529 CTGGCCTTTTTTTGGTTGGTAGG + Intronic
1064150423 10:12859116-12859138 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
1064664088 10:17631925-17631947 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1065075691 10:22076953-22076975 TGGATTTTTTTTTGGTTGGTAGG + Intergenic
1065077213 10:22092817-22092839 TGGACTTTTTTTTGGTTGGTTGG - Intergenic
1065329187 10:24575730-24575752 GAGACTTTTTTTTGGCGGGGGGG + Intergenic
1065443464 10:25774304-25774326 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1066297867 10:34070991-34071013 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1066611851 10:37257023-37257045 GGGCTTTTTTTTTGGTTGGTAGG + Intronic
1066751563 10:38662686-38662708 TGGACTTTTTTTTGGTTGGTGGG - Intergenic
1066965473 10:42260408-42260430 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1067519762 10:46989781-46989803 CAGGGCTTTTTTTGGTTGGTAGG + Intronic
1067642486 10:48062060-48062082 CAGGGCTTTTTTTGGTTGGTAGG - Intergenic
1068126513 10:52847891-52847913 TGGGTGTTTTTTTGGTTGGTAGG + Intergenic
1068196916 10:53729198-53729220 TGGACTTTTTTCTGGTTGGTAGG - Intergenic
1068360563 10:55972008-55972030 GAGATGTTCTTTGGGCTGGTTGG - Intergenic
1068413484 10:56687310-56687332 TGAACTTTTTTTTGGTTGGTAGG - Intergenic
1068540722 10:58292334-58292356 TAGCAGTTTTGTTGGTTGGTTGG - Intergenic
1069056958 10:63854321-63854343 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1069360422 10:67635183-67635205 GGGCCTTTTTTTTGGTTGGTAGG - Intronic
1069497006 10:68914614-68914636 GAGAAATTTTTTTGGTTTGGGGG - Intronic
1070003379 10:72398804-72398826 TGGACTTTTTTTTGGTTGGTAGG - Intronic
1070064524 10:73020435-73020457 CAGAGCTTTTTTTGGTTAGTAGG - Intronic
1071066431 10:81641573-81641595 TTGAACTTTTTTTGGTTGGTAGG + Intergenic
1071244122 10:83743849-83743871 TGGACTGTTTTTTGGTTGGTAGG + Intergenic
1071951061 10:90703020-90703042 TAGCAGTTTGTTTGGTTGGTTGG - Intergenic
1072017531 10:91363807-91363829 CTGGAGTTTTTTTGGTTGGTAGG - Intergenic
1072366497 10:94715812-94715834 TGGACTTTTTTTTTGTTGGTAGG + Intronic
1072374216 10:94797619-94797641 GAACTTTTTTTTTGGTTGGTAGG + Intronic
1072606198 10:96984792-96984814 AAGACGTCTTTTTGGGGGGTTGG - Exonic
1072869516 10:99102494-99102516 CTGGCCTTTTTTTGGTTGGTAGG - Intronic
1072872610 10:99136251-99136273 TCAACGTTTTTTTGGTTGGTAGG - Intronic
1073022542 10:100457952-100457974 TGGACTGTTTTTTGGTTGGTAGG - Intergenic
1074279973 10:112042097-112042119 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
1074664320 10:115701810-115701832 CAGGGATTTTTTTGGTTGGTAGG - Intronic
1074682865 10:115926772-115926794 TAGACTTTTTTTTGGTTGGTAGG - Intronic
1074740481 10:116481192-116481214 GAGATGTTTCTTGGGCTGGTGGG - Intergenic
1075019616 10:118942061-118942083 ATGACGTTATTTTGTTTGGTTGG + Intergenic
1075049187 10:119169977-119169999 TAGAAGTTTTTTTGGTTGTTTGG + Intronic
1075248444 10:120845509-120845531 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1075476500 10:122739441-122739463 AAGGATTTTTTTTGGTTGGTTGG + Intergenic
1075888378 10:125922981-125923003 CAGAGTTTTTTTTGTTTGGTTGG + Intronic
1075950055 10:126469395-126469417 GAGAGGTCTTTTTGGTTGAGTGG - Intronic
1076039282 10:127229238-127229260 GTGAGGTTTGTTTGGTTGGTTGG - Intronic
1076158893 10:128226199-128226221 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1076428582 10:130384743-130384765 GCTTCATTTTTTTGGTTGGTTGG - Intergenic
1076862737 10:133148249-133148271 CTGAAGTTTTTTTGGTTGGTAGG - Intergenic
1076965588 11:80661-80683 TGGACTGTTTTTTGGTTGGTAGG - Intergenic
1078046414 11:7917336-7917358 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1078331169 11:10422740-10422762 CTGAGCTTTTTTTGGTTGGTAGG + Intronic
1078813760 11:14798561-14798583 TGGACTTTTTTTTGGTTGGTAGG + Intronic
1079050032 11:17146524-17146546 GAGACGGGTTTTTGGTGTGTTGG - Intronic
1079447199 11:20568422-20568444 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1079667947 11:23131468-23131490 ATGGCCTTTTTTTGGTTGGTAGG + Intergenic
1079748115 11:24158896-24158918 CAGAGCTTTTTTTGTTTGGTAGG - Intergenic
1079940820 11:26678357-26678379 TATATGTTTTTTTGTTTGGTTGG + Intronic
1079981781 11:27158711-27158733 TTCACGTTTTTTTGTTTGGTTGG + Intergenic
1079998873 11:27324956-27324978 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
1080031754 11:27668773-27668795 GATGGATTTTTTTGGTTGGTAGG - Intronic
1080064916 11:28000757-28000779 GGGTCGTTTTTTTGTTTGGTTGG - Intergenic
1080346547 11:31332008-31332030 CTGAACTTTTTTTGGTTGGTGGG + Intronic
1080555784 11:33416052-33416074 GAGCCTTTTTATTGGTTGGTTGG - Intergenic
1080731440 11:34958886-34958908 AAAATTTTTTTTTGGTTGGTTGG + Intronic
1080951024 11:37033199-37033221 AAAATGTTTCTTTGGTTGGTAGG - Intergenic
1080965310 11:37207706-37207728 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1081339853 11:41914703-41914725 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1081593250 11:44440813-44440835 ATGAGCTTTTTTTGGTTGGTAGG - Intergenic
1081798148 11:45836527-45836549 TGGACTTTTTTTTTGTTGGTAGG - Intergenic
1082196290 11:49310375-49310397 TAGACTTTTTTTTGGTTGGTAGG + Intergenic
1082613977 11:55336092-55336114 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
1082748179 11:56990399-56990421 GATTTTTTTTTTTGGTTGGTAGG - Intergenic
1082924934 11:58535031-58535053 CGGACTTTTTTTTGGTCGGTAGG - Intronic
1083368661 11:62160280-62160302 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
1083753377 11:64775649-64775671 GGGATGTTTATTTGGTTAGTAGG + Intronic
1084046885 11:66574152-66574174 GAGATGTTCTTTGGGCTGGTGGG - Intergenic
1084202177 11:67567460-67567482 AAGACATGTTTTTGGTTGGAAGG + Intergenic
1084353745 11:68623309-68623331 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1084544791 11:69809762-69809784 GTTACGTTTTTTTGGATGGTTGG - Intergenic
1084613586 11:70219624-70219646 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1085645627 11:78220493-78220515 GAGGTGTTTTTCTGGGTGGTGGG - Intronic
1085683074 11:78596166-78596188 GAGAGGTTTTATTAGATGGTGGG + Intergenic
1085930909 11:81082574-81082596 TAGGGCTTTTTTTGGTTGGTAGG + Intergenic
1086132866 11:83419655-83419677 GAGATGTTCCTTGGGTTGGTTGG - Intergenic
1086456566 11:86964711-86964733 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1086530792 11:87782758-87782780 TGGACTTTTTTTTTGTTGGTAGG - Intergenic
1086789539 11:91018299-91018321 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
1086832245 11:91580452-91580474 TTGAACTTTTTTTGGTTGGTAGG - Intergenic
1087098819 11:94346233-94346255 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1087184684 11:95176201-95176223 GAGCAGTTTTGTTGGTTGATAGG + Intronic
1087196601 11:95309998-95310020 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1087314338 11:96588195-96588217 GAGACGTTCCTTGGGCTGGTCGG - Intergenic
1087316702 11:96611745-96611767 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
1087331796 11:96790130-96790152 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
1087383430 11:97438576-97438598 TGGGCATTTTTTTGGTTGGTAGG - Intergenic
1087504258 11:98999939-98999961 TGGACTTTTTTTTGTTTGGTAGG - Intergenic
1087569523 11:99906774-99906796 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
1087668127 11:101073843-101073865 CTGGGGTTTTTTTGGTTGGTAGG - Intronic
1087753825 11:102034048-102034070 TGGACCTTTTTTTGGTTGGTAGG + Intergenic
1087839837 11:102909369-102909391 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1088005143 11:104930587-104930609 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1088038100 11:105342713-105342735 TGGACTTGTTTTTGGTTGGTAGG + Intergenic
1088309403 11:108444329-108444351 TGGACTTTTTTTTGGTTGGTAGG - Intronic
1088516634 11:110642911-110642933 CAGGGCTTTTTTTGGTTGGTAGG + Intronic
1088639830 11:111861425-111861447 ATTCCGTTTTTTTGGTTGGTTGG + Intronic
1088703044 11:112431488-112431510 GGGCTTTTTTTTTGGTTGGTAGG + Intergenic
1088983043 11:114881098-114881120 GAGACATTTATTAGGTTGATTGG + Intergenic
1089248597 11:117140806-117140828 TGGATTTTTTTTTGGTTGGTAGG - Intergenic
1089987102 11:122824940-122824962 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1090105329 11:123848623-123848645 TTGAGGTTTTTCTGGTTGGTAGG + Intergenic
1090527065 11:127547937-127547959 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1090546773 11:127774369-127774391 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1090872227 11:130758556-130758578 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1090891995 11:130932013-130932035 TAAATGTTTGTTTGGTTGGTTGG - Intergenic
1091246915 11:134104867-134104889 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
1092579583 12:9823994-9824016 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
1092925100 12:13264988-13265010 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1093071440 12:14710027-14710049 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1093248652 12:16771662-16771684 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1093335732 12:17902670-17902692 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
1093578446 12:20763468-20763490 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1093584779 12:20822055-20822077 GAGATGTTTCTTGGGCTGGTCGG + Intronic
1093599645 12:21006192-21006214 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
1093660230 12:21748387-21748409 CTGAACTTTTTTTGGTTGGTAGG - Intronic
1093677921 12:21965721-21965743 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1094127959 12:27043532-27043554 GAGGTCTTTTTTTGATTGGTAGG - Intronic
1094710055 12:32953017-32953039 GAGACGGTTTTTGAGTTGGCAGG + Intergenic
1095118395 12:38384263-38384285 CTGGGGTTTTTTTGGTTGGTAGG - Intergenic
1095437274 12:42204075-42204097 TAGATTTTTTTTTGTTTGGTTGG - Intronic
1095793492 12:46192561-46192583 TGGACTTTTTTTTGGTTGGTAGG + Intronic
1095808646 12:46348433-46348455 CTGGCCTTTTTTTGGTTGGTAGG + Intergenic
1096891928 12:54780238-54780260 TGGACCTTTTTTTGGTTGGTAGG - Intergenic
1097139780 12:56891411-56891433 TGGACTTTTTTTTGGTTGATAGG - Intergenic
1097910391 12:64963357-64963379 GGGCTTTTTTTTTGGTTGGTAGG + Intergenic
1098401929 12:70085837-70085859 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1098732673 12:74059060-74059082 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
1099053149 12:77805795-77805817 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1099071019 12:78045861-78045883 TGGGCATTTTTTTGGTTGGTAGG + Intronic
1099108216 12:78522453-78522475 TGGGCCTTTTTTTGGTTGGTAGG - Intergenic
1099292393 12:80788356-80788378 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1099319847 12:81132257-81132279 TGGACTTTTTTTTGGTTGGTAGG + Intronic
1099427980 12:82547805-82547827 TGCACTTTTTTTTGGTTGGTAGG + Intergenic
1099492378 12:83303242-83303264 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
1099555094 12:84100926-84100948 TGGACTTTTTTTTAGTTGGTAGG - Intergenic
1099762290 12:86939242-86939264 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1099767346 12:87004609-87004631 AGGACATTTTTTTGGTTGGTAGG + Intergenic
1100381657 12:94067767-94067789 TGGACTTTTTTTTGGTTGCTAGG - Intergenic
1100896584 12:99189204-99189226 TGGACTTTTTTTTGGTTGGTAGG - Intronic
1101182862 12:102238762-102238784 CTGGAGTTTTTTTGGTTGGTGGG - Intergenic
1101487634 12:105181590-105181612 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
1101600932 12:106209406-106209428 TGGACTTTTTTTTGGTTGATAGG + Intergenic
1102117024 12:110410575-110410597 GAGATGTTCTTTGGGCTGGTTGG + Intergenic
1103504148 12:121429846-121429868 GACACTTTTTTTTGTTTGGTTGG - Exonic
1104770479 12:131359185-131359207 GAGTTGGTTTTTTGTTTGGTTGG - Intergenic
1105226628 13:18440851-18440873 CAGGGCTTTTTTTGGTTGGTAGG + Intergenic
1105283773 13:18987220-18987242 GTGGACTTTTTTTGGTTGGTAGG - Intergenic
1105430088 13:20328818-20328840 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1105672371 13:22633686-22633708 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1105769747 13:23597609-23597631 CTGAGCTTTTTTTGGTTGGTAGG - Intronic
1106215770 13:27697567-27697589 CAGGGCTTTTTTTGGTTGGTAGG + Intergenic
1106349420 13:28913745-28913767 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
1106492917 13:30244911-30244933 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
1106980514 13:35273876-35273898 TGGACTTTTTTTTGGTTGGTAGG - Intronic
1107075269 13:36316877-36316899 GAGATGTTTCTTGGGCTGGTCGG - Intronic
1107243990 13:38270499-38270521 GTGGGCTTTTTTTGGTTGGTAGG - Intergenic
1107309194 13:39058693-39058715 CAGGACTTTTTTTGGTTGGTAGG + Intergenic
1107310932 13:39076940-39076962 CAGGGCTTTTTTTGGTTGGTAGG - Intergenic
1107370648 13:39743616-39743638 TGGACTTTTTTTTGGTTGGTAGG - Intronic
1107439889 13:40416749-40416771 TGGACTTTTTTTTGATTGGTAGG - Intergenic
1107683427 13:42872574-42872596 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1107862017 13:44670134-44670156 GAGGCTTTTTTTTGGTGGGGGGG + Intergenic
1108113806 13:47106124-47106146 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
1108155676 13:47582513-47582535 TAGGGATTTTTTTGGTTGGTAGG - Intergenic
1108170637 13:47738271-47738293 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
1108480006 13:50859426-50859448 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1108579005 13:51812716-51812738 GTCAGGTTTTTTTGGTTGGTTGG - Intergenic
1108858401 13:54823879-54823901 GTGGGCTTTTTTTGGTTGGTAGG - Intergenic
1108865804 13:54921234-54921256 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
1108919841 13:55660225-55660247 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1109216356 13:59594149-59594171 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1109363550 13:61327086-61327108 CAGGACTTTTTTTGGTTGGTAGG - Intergenic
1109450624 13:62509567-62509589 AGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1109727911 13:66369078-66369100 GAGATTTTTCTTTGGTTTGTTGG + Intronic
1110199396 13:72830901-72830923 TGGATTTTTTTTTGGTTGGTAGG + Intronic
1110206579 13:72921449-72921471 GAGTGGTTATTTTGGATGGTAGG - Intronic
1110465380 13:75794308-75794330 GAGATGTTTTTTTGGGAGGTGGG + Intronic
1110656098 13:78001850-78001872 TGGGCATTTTTTTGGTTGGTAGG - Intergenic
1110765164 13:79274601-79274623 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1110825032 13:79961944-79961966 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1110978169 13:81866614-81866636 GAGATGTTCTTTGGGCTGGTGGG - Intergenic
1111061226 13:83021355-83021377 GATACTTTTTTTTTTTTGGTAGG + Intergenic
1111126290 13:83913281-83913303 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1111341864 13:86897383-86897405 TGGCCTTTTTTTTGGTTGGTAGG - Intergenic
1111459174 13:88518161-88518183 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1111712394 13:91833256-91833278 TTGAGGTTTTTTTGGTTGGTAGG - Intronic
1111747088 13:92284251-92284273 TGGACTTTTTTTTGGTTGGTAGG - Intronic
1112069120 13:95828680-95828702 TGGAGTTTTTTTTGGTTGGTAGG - Intronic
1112130784 13:96521480-96521502 TGGACTTTTTTTTGGTTGGTAGG + Intronic
1112236546 13:97642823-97642845 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1113293865 13:108936352-108936374 CAGAGCTTTTTTTGGTTGGTAGG + Intronic
1113323979 13:109265629-109265651 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1113351966 13:109538211-109538233 GAGACGTTTTTTTGCCATGTTGG + Intergenic
1114147034 14:19989536-19989558 CAGAGATTTTCTTGGTTGGTAGG - Intergenic
1114741884 14:25105729-25105751 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1114956016 14:27820260-27820282 GGGTCTTTTTTTTGGTTGGTAGG + Intergenic
1115035197 14:28848731-28848753 TGGACTTTCTTTTGGTTGGTAGG - Intergenic
1115135316 14:30100940-30100962 TGGATTTTTTTTTGGTTGGTAGG - Intronic
1115240912 14:31250540-31250562 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1115265710 14:31498037-31498059 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
1115311251 14:31980581-31980603 CAGTGCTTTTTTTGGTTGGTAGG + Intergenic
1115461269 14:33663673-33663695 CTGGGGTTTTTTTGGTTGGTAGG + Intronic
1115940013 14:38598456-38598478 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
1115974081 14:38977819-38977841 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1115998837 14:39221038-39221060 GAGACGTCTTTTTGTTTGTTTGG - Intergenic
1116024976 14:39504102-39504124 GGGCTTTTTTTTTGGTTGGTAGG + Intergenic
1116035725 14:39625107-39625129 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1116074119 14:40088206-40088228 GGGCTTTTTTTTTGGTTGGTGGG + Intergenic
1116318196 14:43425373-43425395 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1116670968 14:47842789-47842811 CAGAGGTTTTTCTGGTTGGTGGG + Intergenic
1116703605 14:48267740-48267762 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1116717420 14:48445581-48445603 TGGACATTTTTTTGGTTGGTAGG - Intergenic
1116734711 14:48674325-48674347 GAGGACTTTTTTTGGTTGTTAGG - Intergenic
1116771705 14:49133701-49133723 GAGAGGTTTTCTGGGTTGGCAGG - Intergenic
1116952623 14:50893720-50893742 GAGATGTTTCTTGGGCTGGTCGG - Intronic
1116985624 14:51216239-51216261 CAGGACTTTTTTTGGTTGGTAGG + Intergenic
1117416006 14:55496217-55496239 TGGACCTTTTTTTGGTTGGTAGG + Intergenic
1117781307 14:59235272-59235294 CTGAGCTTTTTTTGGTTGGTAGG + Intronic
1117801051 14:59445386-59445408 GAGATGTTTTTTGGGCTGGTCGG - Intronic
1118143327 14:63108982-63109004 GGGCTTTTTTTTTGGTTGGTAGG + Intergenic
1118226617 14:63906433-63906455 CAGAGCTTTTTTTGGTTGGTAGG + Intronic
1118546746 14:66898394-66898416 GAGGTGTTTTTTCGTTTGGTTGG + Intronic
1118937605 14:70301407-70301429 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1118976311 14:70679823-70679845 CTGAGGTTTTTTTGTTTGGTTGG - Intergenic
1119022107 14:71124724-71124746 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1119111144 14:71975432-71975454 GAGACTTCTTTTTATTTGGTTGG + Intronic
1119744097 14:77032339-77032361 GATTCTTTTTTTTGGTTGGGGGG - Intergenic
1120021768 14:79539047-79539069 GACAGGTTTTGTTTGTTGGTTGG + Intronic
1120058779 14:79957064-79957086 TGGGCTTTTTTTTGGTTGGTGGG - Intergenic
1120449746 14:84652253-84652275 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1120625052 14:86814663-86814685 CAGGCCTTATTTTGGTTGGTAGG + Intergenic
1120797771 14:88653917-88653939 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
1120807048 14:88763517-88763539 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
1121470417 14:94149286-94149308 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
1121703366 14:95973540-95973562 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1121980800 14:98452084-98452106 GAGATGTTCTTTAGGCTGGTCGG + Intergenic
1122040720 14:98985794-98985816 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1123576307 15:21673123-21673145 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1123612930 15:22115591-22115613 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1123984065 15:25629245-25629267 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
1125045445 15:35239170-35239192 GAGATGTTTCTTGGGCTGGTAGG - Intronic
1125351875 15:38776222-38776244 TGGACTTTTTTTTCGTTGGTAGG + Intergenic
1125846708 15:42862098-42862120 CAGAGCTTTTTTTGGTTGGTAGG - Intronic
1126074201 15:44893159-44893181 TGGACTTTTTTTTGGTTGATAGG + Intergenic
1126080446 15:44956464-44956486 GTGAGGGTTTTTTGTTTGGTTGG - Intergenic
1126084011 15:44993886-44993908 TGGACGATTTTTTGGTTGGTAGG - Intergenic
1126206516 15:46051388-46051410 CAGGACTTTTTTTGGTTGGTAGG + Intergenic
1126853890 15:52818666-52818688 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1126863018 15:52905547-52905569 TGGACTTTTTTTTGGTCGGTAGG - Intergenic
1126912658 15:53431900-53431922 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1126950802 15:53878837-53878859 CAGAGGTTCATTTGGTTGGTTGG - Intergenic
1127326620 15:57901875-57901897 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1127355657 15:58196906-58196928 TGGAATTTTTTTTGGTTGGTAGG - Intronic
1127400970 15:58585512-58585534 AAGAGGGTTTTTTGTTTGGTTGG + Intergenic
1127405172 15:58636722-58636744 AAGACTTTTTTTTGGGGGGTGGG - Intronic
1127570921 15:60240671-60240693 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1128268844 15:66291374-66291396 GTGCCTTTTTGTTGGTTGGTTGG - Intergenic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131545425 15:93311980-93312002 GTGACGGTTGGTTGGTTGGTTGG + Intergenic
1131591176 15:93750173-93750195 TGGGCTTTTTTTTGGTTGGTGGG - Intergenic
1132006206 15:98229699-98229721 GGGACATTTTATTAGTTGGTTGG + Intergenic
1132007857 15:98246335-98246357 TAGAGTTTTTTCTGGTTGGTAGG + Intergenic
1132262706 15:100440717-100440739 GAGATGTTTCTTGGGCTGGTCGG - Intronic
1132340121 15:101073048-101073070 GAGATGTTTCTTGGGCTGGTTGG - Intronic
1132442548 15:101882860-101882882 TGGACTGTTTTTTGGTTGGTAGG + Intergenic
1202985175 15_KI270727v1_random:407368-407390 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1133510576 16:6453543-6453565 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
1133766993 16:8844897-8844919 GAGATGTTTCTTGGGCTGGTGGG + Intronic
1133869902 16:9676690-9676712 GAGATGTTTCTTGGGCTGGTTGG + Exonic
1134342403 16:13357444-13357466 GAGATGTTTCTTGGGCTGGTGGG + Intergenic
1134755283 16:16661650-16661672 TCGACTTTTTTTTAGTTGGTTGG - Intergenic
1134767307 16:16771625-16771647 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1137336116 16:47550845-47550867 CTGGGGTTTTTTTGGTTGGTAGG + Intronic
1137461161 16:48664963-48664985 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
1137503726 16:49032198-49032220 TGGACTTTTTTTTTGTTGGTAGG - Intergenic
1138804602 16:60079095-60079117 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1138846880 16:60577822-60577844 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1139039714 16:62984972-62984994 GAGATGTTTCTTGGGCTGGTGGG + Intergenic
1139936004 16:70571718-70571740 GAGACGTTCTTTTGTTTGTTGGG - Exonic
1140582858 16:76251914-76251936 TGGACTTTTTTTTGGTGGGTAGG + Intergenic
1140695450 16:77528475-77528497 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1140954931 16:79854171-79854193 CGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1141071365 16:80958159-80958181 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
1141119679 16:81343140-81343162 TGGACTTTTTTTTGGTTGGTAGG - Intronic
1141245806 16:82306044-82306066 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
1141796468 16:86278643-86278665 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1141865476 16:86747073-86747095 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1143337379 17:6182372-6182394 GTTTTGTTTTTTTGGTTGGTAGG - Intergenic
1143796261 17:9339314-9339336 TAGAAGTTTTCTTGATTGGTTGG - Intronic
1145080880 17:19893365-19893387 GAGATGTTCCTTGGGTTGGTTGG + Intergenic
1145396471 17:22499583-22499605 CAGATGTTTTTTTGGTTAGTAGG + Intergenic
1146093296 17:29904012-29904034 GGGCTTTTTTTTTGGTTGGTAGG - Intronic
1146116745 17:30147429-30147451 CAGACTTTTGTTTGTTTGGTTGG + Intronic
1146132322 17:30289189-30289211 CAGAACTGTTTTTGGTTGGTAGG - Intronic
1146298215 17:31667545-31667567 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
1146608172 17:34280540-34280562 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
1147525742 17:41220945-41220967 GGGCTTTTTTTTTGGTTGGTAGG - Intronic
1149061212 17:52424331-52424353 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
1149063941 17:52458110-52458132 TGGACTTTTTTTTGGTTCGTAGG - Intergenic
1149136936 17:53378235-53378257 AAGGCTTTTTTTTGGTGGGTAGG + Intergenic
1149191631 17:54070045-54070067 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
1149235925 17:54590663-54590685 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
1149352220 17:55802228-55802250 CTGAGCTTTTTTTGGTTGGTAGG - Intronic
1149359239 17:55875928-55875950 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
1149365773 17:55942466-55942488 GGGGCTTTTTTGTGGTTGGTAGG - Intergenic
1149552931 17:57553415-57553437 GAGACGTTTATTTGGTGGGAGGG + Intronic
1150101961 17:62431690-62431712 CAGTGGTTTTTTTGTTTGGTTGG + Intronic
1150161839 17:62905045-62905067 GAGACCTCTTTTGGGTGGGTGGG + Intergenic
1150457751 17:65321188-65321210 GATATGTTTTCTAGGTTGGTAGG - Intergenic
1150533484 17:66011087-66011109 CTGGGGTTTTTTTGGTTGGTAGG + Intronic
1150881802 17:69038079-69038101 CTGAGCTTTTTTTGGTTGGTAGG - Intronic
1151840007 17:76610953-76610975 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1151869953 17:76829755-76829777 TTGTAGTTTTTTTGGTTGGTTGG - Intergenic
1153215581 18:2817554-2817576 GAGTTTTTTTTTTGTTTGGTTGG - Intergenic
1153371690 18:4324378-4324400 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
1153717538 18:7865813-7865835 TGGAGTTTTTTTTGGTTGGTAGG + Intronic
1154298166 18:13168800-13168822 CAGAGGTTTTTTTGTTTGGTTGG - Intergenic
1155127094 18:22888871-22888893 CTGGCCTTTTTTTGGTTGGTAGG - Intronic
1155253725 18:23976010-23976032 CTGAGTTTTTTTTGGTTGGTAGG + Intergenic
1155672748 18:28391606-28391628 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1155697317 18:28698319-28698341 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1155935479 18:31748476-31748498 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1155961733 18:32001050-32001072 GAGATGTTCCTTGGGTTGGTTGG - Intergenic
1156124673 18:33889382-33889404 CAGGACTTTTTTTGGTTGGTAGG - Intronic
1156422413 18:36969646-36969668 TTGAGATTTTTTTGGTTGGTAGG - Intronic
1156884506 18:42118590-42118612 GAGGAGTTTTTTTGTTTGTTTGG - Intergenic
1156938333 18:42737548-42737570 GAGATGTTTCTTGGGCTGGTAGG - Intergenic
1157053941 18:44202450-44202472 CAGAGCTTTTTTTAGTTGGTAGG - Intergenic
1157057949 18:44252872-44252894 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1157752347 18:50190618-50190640 GTGATTTTTTTTTGGTAGGTCGG - Intronic
1157940703 18:51925915-51925937 GAAAGGTTTTTTTTTTTGGTCGG - Intergenic
1158082112 18:53605111-53605133 GTTTTGTTTTTTTGGTTGGTTGG + Intergenic
1158394950 18:57071920-57071942 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1159076980 18:63691569-63691591 CTGAGCTTTTTTTGGTTGGTAGG - Intronic
1159557884 18:69963951-69963973 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1159630092 18:70739345-70739367 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1160440551 18:78887431-78887453 GGGGGCTTTTTTTGGTTGGTAGG - Intergenic
1160466425 18:79081248-79081270 GTGGGCTTTTTTTGGTTGGTAGG + Intronic
1160642392 19:150291-150313 TGGACTGTTTTTTGGTTGGTAGG - Intergenic
1160982081 19:1821014-1821036 GTTTTGTTTTTTTGGTTGGTTGG - Intronic
1163487027 19:17594033-17594055 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1163900582 19:20096205-20096227 GAGATGTTTCTTGGGCTGGTCGG + Intronic
1163906743 19:20155073-20155095 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1164152706 19:22568861-22568883 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1164416995 19:28054887-28054909 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1166616337 19:44251260-44251282 GGGCTTTTTTTTTGGTTGGTAGG - Intronic
1167900848 19:52621208-52621230 GAGACGTTCCTTGGGCTGGTTGG - Intronic
1168051335 19:53831964-53831986 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
925728786 2:6901449-6901471 GGGCTTTTTTTTTGGTTGGTAGG + Intergenic
926413276 2:12626879-12626901 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
926464365 2:13169132-13169154 GAGATGTTTCTTCGGCTGGTTGG + Intergenic
926578894 2:14613413-14613435 GTGAGGTTTTTTTGTTTGGTTGG + Intergenic
926746216 2:16160547-16160569 TACAAGTTTTGTTGGTTGGTTGG - Intergenic
926876934 2:17491035-17491057 CTGGCCTTTTTTTGGTTGGTAGG + Intergenic
926970321 2:18460838-18460860 TGGAATTTTTTTTGGTTGGTAGG + Intergenic
927133946 2:20083122-20083144 GAGATGTTCTTTGGGCTGGTTGG - Intergenic
927610464 2:24534072-24534094 TGGACTTTTTTTTGGTTGGTAGG + Intronic
928532476 2:32206625-32206647 AAGATTTTTTGTTGGTTGGTTGG + Intronic
928827887 2:35442053-35442075 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
928928277 2:36599636-36599658 GAGATGTTTTTTGGGCTGGTCGG - Intronic
929793368 2:45039627-45039649 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
929926947 2:46221130-46221152 TGGACTTTTTTTTGGTTCGTAGG - Intergenic
930150605 2:48055515-48055537 CTGGCCTTTTTTTGGTTGGTAGG + Intergenic
930222983 2:48764185-48764207 CTGAGGTTTTTTTGGTTGATAGG + Intronic
930673390 2:54175159-54175181 TGGAGTTTTTTTTGGTTGGTAGG + Intronic
931236591 2:60417943-60417965 GAGATGTTTCTTCGGCTGGTCGG - Intergenic
931560797 2:63558794-63558816 CTGGCGTTTTTTTGGTTGGTAGG - Intronic
931594824 2:63930025-63930047 CTGAACTTTTTTTGGTTGGTAGG - Intronic
931625470 2:64253005-64253027 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
931815211 2:65893780-65893802 TGGTCTTTTTTTTGGTTGGTAGG - Intergenic
931850130 2:66244446-66244468 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
931947957 2:67332024-67332046 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
932295530 2:70621007-70621029 GAGATGTTTCTTGGGCTGGTCGG - Intronic
932854491 2:75218948-75218970 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
932941699 2:76174189-76174211 CAGGGCTTTTTTTGGTTGGTAGG + Intergenic
932974257 2:76579122-76579144 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
933012776 2:77088784-77088806 GAGATGTTTCTTGGGCTGGTGGG - Intronic
933094705 2:78163582-78163604 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
933552645 2:83793941-83793963 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
933606102 2:84385596-84385618 GGGCTTTTTTTTTGGTTGGTAGG + Intergenic
934152915 2:89165909-89165931 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
934214324 2:90016022-90016044 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
934868701 2:97839351-97839373 TGGGGGTTTTTTTGGTTGGTTGG - Intronic
935010622 2:99132254-99132276 GGGCTTTTTTTTTGGTTGGTAGG + Intronic
935246703 2:101225124-101225146 GGGTCTTTTTTTTGGTTTGTTGG - Intronic
935450542 2:103204048-103204070 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
935491000 2:103720118-103720140 TGGATTTTTTTTTGGTTGGTAGG - Intergenic
935491615 2:103727873-103727895 CAGGCCTTTTTTTGGTTGCTAGG + Intergenic
935604420 2:104956233-104956255 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
935609268 2:105004281-105004303 GACTTGTTTTTTTGTTTGGTTGG + Intergenic
936390911 2:112072408-112072430 TCGGCCTTTTTTTGGTTGGTAGG + Intronic
936668533 2:114627971-114627993 GAGATGATGTCTTGGTTGGTTGG + Intronic
936794508 2:116189168-116189190 GAGACGTTCCTTGGGCTGGTTGG + Intergenic
936808059 2:116361366-116361388 CTGGGGTTTTTTTGGTTGGTAGG - Intergenic
936900439 2:117476056-117476078 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
937058999 2:118967612-118967634 GAGTGGTTTTGTTGGTGGGTTGG - Intronic
937075193 2:119099210-119099232 TAGACTTTTTTTTGGTTGGTAGG - Intergenic
937143525 2:119622379-119622401 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
937352433 2:121174822-121174844 GAGACCATTTTTGGGGTGGTGGG - Intergenic
938217761 2:129535310-129535332 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
938788675 2:134657223-134657245 CAGAGCTCTTTTTGGTTGGTAGG + Intronic
938975373 2:136472203-136472225 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
939083423 2:137688122-137688144 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
939160020 2:138576719-138576741 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
939180701 2:138799439-138799461 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
939278755 2:140036210-140036232 AAGACTTTTTTTTGGTTTTTAGG - Intergenic
939307186 2:140426911-140426933 GAGATGTTTCTTGGGCTGGTTGG - Intronic
939840925 2:147185894-147185916 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
939912697 2:148003123-148003145 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
939987529 2:148845310-148845332 CAGAGCTTTTTTTGGTTGGTAGG + Intergenic
940819019 2:158330638-158330660 TGGACTTTTTTTTGGTTGGTAGG + Intronic
940819589 2:158337367-158337389 AAGAGGATTTTTTGTTTGGTAGG - Intronic
940821706 2:158363175-158363197 TGGACTTTTTTTTGGTTGATAGG - Intronic
941050321 2:160725298-160725320 GGGCTTTTTTTTTGGTTGGTAGG + Intergenic
941115768 2:161470534-161470556 GAAATGTTTTTTTGTTTGGAGGG - Intronic
941143208 2:161810994-161811016 CAGGGCTTTTTTTGGTTGGTAGG + Intronic
941340114 2:164296368-164296390 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
941456461 2:165715586-165715608 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
941563566 2:167079461-167079483 GGGGCCTTTTATTGGTTGGTGGG + Intronic
941608787 2:167634712-167634734 GGGATTTTTTTTTGGTTGGTAGG - Intergenic
941701524 2:168609127-168609149 GAGAGGTTATCTTGGATGGTTGG + Intronic
941763266 2:169268118-169268140 TGGACATTTTTTGGGTTGGTAGG - Intronic
941845635 2:170129434-170129456 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
942350215 2:175044659-175044681 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
942375302 2:175330557-175330579 GAGACATGTTTCAGGTTGGTAGG + Intergenic
942744408 2:179215502-179215524 TGGACTTTTTTTTGGTTGGTAGG - Intronic
943274513 2:185849558-185849580 GACTTTTTTTTTTGGTTGGTAGG - Intergenic
943413214 2:187565566-187565588 GAGATGTTTCTTGGGCTGGTTGG + Intronic
943421874 2:187675687-187675709 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
943564277 2:189498857-189498879 TAGCCATTTTTTTGTTTGGTTGG - Intergenic
944094412 2:195950235-195950257 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
944292368 2:198021756-198021778 TGGTCTTTTTTTTGGTTGGTAGG - Intronic
944387158 2:199179924-199179946 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
944608253 2:201373138-201373160 TGGGTGTTTTTTTGGTTGGTAGG - Intergenic
944630132 2:201616069-201616091 CTGGAGTTTTTTTGGTTGGTAGG - Intronic
944635519 2:201672763-201672785 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
944876423 2:203967146-203967168 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
945046113 2:205783503-205783525 GAGACTTTTTCTTGGTGTGTAGG - Intronic
945161556 2:206896845-206896867 CTGACTTTTTTTTGGTTGGTAGG + Intergenic
945371451 2:209023670-209023692 GTGGACTTTTTTTGGTTGGTAGG - Intergenic
945479879 2:210333037-210333059 GGGCTTTTTTTTTGGTTGGTAGG + Intergenic
945496645 2:210515327-210515349 TAGAGCTTTTTTTGGTTGGTAGG + Intronic
945597102 2:211809318-211809340 CTGGAGTTTTTTTGGTTGGTAGG + Intronic
945927729 2:215822833-215822855 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
946205593 2:218105182-218105204 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
946781322 2:223194970-223194992 GAGATGTTTCTTGGGCTGGTTGG + Intronic
946886212 2:224225838-224225860 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
946892975 2:224297152-224297174 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
946950416 2:224868037-224868059 GAGAGGTTTTTTTTGTGTGTGGG + Intronic
946974073 2:225128527-225128549 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
947146777 2:227075015-227075037 GTGGGCTTTTTTTGGTTGGTAGG - Intronic
947266452 2:228287552-228287574 GGTATTTTTTTTTGGTTGGTAGG + Intergenic
947479768 2:230488378-230488400 GAGAGTTTTTTTTGTTTGTTTGG + Intronic
947681084 2:232034098-232034120 TGGGCCTTTTTTTGGTTGGTAGG + Intronic
948026172 2:234778979-234779001 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
948141428 2:235675156-235675178 GACACTTTTTGTTGGTTGGTTGG + Intronic
948556692 2:238816507-238816529 AACACGATGTTTTGGTTGGTAGG - Intergenic
948580504 2:238984738-238984760 CAGTCATTTTTGTGGTTGGTGGG + Intergenic
948940464 2:241193035-241193057 AAGATGGTTTTTTGTTTGGTTGG + Intronic
1169306792 20:4498435-4498457 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
1169319658 20:4621620-4621642 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1169418691 20:5441131-5441153 TGAACTTTTTTTTGGTTGGTAGG - Intergenic
1169671054 20:8102867-8102889 CAGGGCTTTTTTTGGTTGGTAGG + Intergenic
1169861987 20:10162575-10162597 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
1170294555 20:14809949-14809971 TGGGCCTTTTTTTGGTTGGTAGG - Intronic
1170752542 20:19164271-19164293 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
1170820976 20:19756223-19756245 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1171082416 20:22200508-22200530 CAGACTTCTTTTTGGTTGATAGG - Intergenic
1171136042 20:22695251-22695273 GAGAGGATTTTTTGGTTTTTAGG + Intergenic
1171256907 20:23696040-23696062 TGGACTTTTTTTTGGTTAGTAGG - Intergenic
1171272464 20:23827549-23827571 GAGATTTTTTTTTTGTTGGAGGG + Intergenic
1171410713 20:24946286-24946308 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1172864118 20:38082187-38082209 CAGGGCTTTTTTTGGTTGGTAGG + Intronic
1173118585 20:40269610-40269632 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1173354454 20:42273992-42274014 GAGAGATTTTTCTAGTTGGTGGG + Intronic
1173358630 20:42319293-42319315 TATACGTTTTATTGGTTTGTAGG - Intronic
1173781354 20:45759861-45759883 GAGATGTTTCTTGGGCTGGTCGG - Intronic
1174032197 20:47638805-47638827 GAGACCCTTTTTTGGCTGGCAGG + Intronic
1174965282 20:55206763-55206785 CAGAAATTTTTTTGGTTGGTAGG + Intergenic
1176770678 21:13069878-13069900 CAGGGCTTTTTTTGGTTGGTAGG + Intergenic
1176978133 21:15347983-15348005 AGGACATTTTTTTGGTTGGTAGG - Intergenic
1177099468 21:16882326-16882348 GGGATTTTTTTTTGGTTGGTAGG - Intergenic
1177106450 21:16962032-16962054 GATACATTTTTTTGTTTGGTTGG + Intergenic
1177120934 21:17136389-17136411 AGGACTTCTTTTTGGTTGGTAGG - Intergenic
1177229617 21:18302758-18302780 CAGACGTATTTTTGGTAGGAAGG - Intronic
1177463574 21:21444463-21444485 GGGCTTTTTTTTTGGTTGGTAGG + Intronic
1178049868 21:28735655-28735677 GTGACGTTTTGTTGGTTGATTGG + Intergenic
1178501197 21:33126866-33126888 GAGAGGTTTTTTTTGTTTTTTGG + Intergenic
1178991446 21:37359851-37359873 GAGTTTTTTGTTTGGTTGGTTGG - Intergenic
1179938366 21:44620192-44620214 AAGACGTCTTTTTGGTTGTTGGG - Intronic
1180377535 22:12108439-12108461 CAGGAGTTTTTTTGGTTGGTAGG + Intergenic
1180541317 22:16450723-16450745 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1180560617 22:16611855-16611877 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1180640636 22:17295927-17295949 TGGACTTTATTTTGGTTGGTAGG + Intergenic
1181356621 22:22300524-22300546 GAACAGTTTTTTTGTTTGGTTGG + Intergenic
1181896667 22:26114972-26114994 CACAGCTTTTTTTGGTTGGTAGG - Intergenic
1182113659 22:27742542-27742564 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1182938626 22:34252102-34252124 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1183021165 22:35027581-35027603 GGGCTGTTTTTTTGGTTGGTAGG + Intergenic
1183635895 22:39062434-39062456 GAGATGTTCCTTTGGCTGGTTGG + Intronic
949173620 3:1032518-1032540 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
949239467 3:1852596-1852618 TAGCCTTTTTTTTGGTTGGTAGG + Intergenic
949453633 3:4214908-4214930 CGGAACTTTTTTTGGTTGGTGGG - Intronic
950766139 3:15274479-15274501 CACACTTTTTTTTTGTTGGTTGG + Intronic
951012460 3:17696615-17696637 TGGACTTTTTTTTGGTTGGTAGG - Intronic
951182849 3:19679304-19679326 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
951433937 3:22640243-22640265 CCGGCCTTTTTTTGGTTGGTAGG + Intergenic
951763038 3:26165342-26165364 GAGATGTTCCTTGGGTTGGTTGG + Intergenic
951789775 3:26467530-26467552 CTGGAGTTTTTTTGGTTGGTAGG - Intergenic
952155432 3:30638680-30638702 AAGGTGTTTGTTTGGTTGGTTGG + Intronic
952631942 3:35479996-35480018 CAGGACTTTTTTTGGTTGGTAGG + Intergenic
952663743 3:35879535-35879557 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
953077441 3:39583077-39583099 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
953079762 3:39605280-39605302 GGGATTTTTTTTTAGTTGGTAGG + Intergenic
953110122 3:39927557-39927579 CAGGGATTTTTTTGGTTGGTAGG - Intronic
953443753 3:42944260-42944282 GTGAAGTTATTTTGGGTGGTGGG + Intronic
953523197 3:43662904-43662926 TTGAACTTTTTTTGGTTGGTAGG - Intronic
953825998 3:46251476-46251498 GAGATGTTTCTTGGGCTGGTCGG + Intronic
953963788 3:47286475-47286497 GAGATGTTTTCTTGACTGGTGGG + Intronic
954769722 3:52955716-52955738 CTGAGCTTTTTTTGGTTGGTAGG - Intronic
954836192 3:53470566-53470588 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
954969546 3:54639621-54639643 GAGATGTTTCTTGGGCTGGTTGG + Intronic
955143719 3:56295059-56295081 GAGTCACTTGTTTGGTTGGTCGG - Intronic
955871376 3:63442034-63442056 GTTATGGTTTTTTGGTTGGTTGG + Intronic
956038732 3:65123563-65123585 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
956386179 3:68722025-68722047 TAGGCTGTTTTTTGGTTGGTAGG + Intergenic
956397791 3:68844146-68844168 CTGAGCTTTTTTTGGTTGGTAGG + Intronic
956708956 3:72023642-72023664 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
957001278 3:74888016-74888038 TAGGGGTTTTTTTGTTTGGTTGG + Intergenic
957256292 3:77842028-77842050 TTGGCTTTTTTTTGGTTGGTAGG + Intergenic
957475146 3:80712939-80712961 GAGGTATTTTTTTGGTTGGTAGG - Intergenic
958503423 3:94943533-94943555 CCGAGGTTTTTTTGTTTGGTAGG + Intergenic
958553848 3:95648563-95648585 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
959278506 3:104307813-104307835 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
959422624 3:106147826-106147848 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
959486041 3:106927851-106927873 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
959828683 3:110833480-110833502 CTGGGGTTTTTTTGGTTGGTGGG + Intergenic
959883216 3:111470515-111470537 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
960069675 3:113414991-113415013 TGGAGTTTTTTTTGGTTGGTAGG + Intronic
960612267 3:119565801-119565823 TGGATTTTTTTTTGGTTGGTAGG + Intergenic
960835749 3:121904978-121905000 CTGGCCTTTTTTTGGTTGGTAGG + Intronic
961310907 3:126000040-126000062 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
961730301 3:128960361-128960383 GAGATGTTTCTTGGGCTGGTCGG - Intronic
961982969 3:131100869-131100891 CAGGACTTTTTTTGGTTGGTAGG + Intronic
962531071 3:136280812-136280834 AGAAAGTTTTTTTGGTTGGTCGG - Intronic
962660386 3:137596158-137596180 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
962666357 3:137657701-137657723 TTGACTTTTTTTTGGTTGGTAGG - Intergenic
962832146 3:139153077-139153099 CTGAGCTTTTTTTGGTTGGTAGG - Intronic
963481183 3:145876664-145876686 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
963489950 3:145987260-145987282 AAGGCTTTTTTCTGGTTGGTAGG - Intergenic
963663018 3:148152067-148152089 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
963992722 3:151671945-151671967 TAGTCTTTTTTTTGGTTGGGTGG + Intergenic
964214651 3:154266079-154266101 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
964243492 3:154622872-154622894 TCGGCTTTTTTTTGGTTGGTAGG - Intergenic
964533676 3:157696119-157696141 GAGAAGTTTTTTTTTTTGGAGGG - Intergenic
964759337 3:160119388-160119410 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
965010364 3:163080412-163080434 CTGGAGTTTTTTTGGTTGGTGGG - Intergenic
965036633 3:163448010-163448032 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
965105501 3:164347309-164347331 GAGATGCTTTTTGGGCTGGTCGG + Intergenic
965292870 3:166906517-166906539 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
965293995 3:166919392-166919414 CTGAACTTTTTTTGGTTGGTTGG - Intergenic
965393351 3:168131800-168131822 TGGACTTTTTTTTAGTTGGTAGG - Intergenic
965621616 3:170647769-170647791 CAGGGCTTTTTTTGGTTGGTAGG + Intronic
965626635 3:170688675-170688697 GAGATGTTTCTTGGGCTGGTCGG + Intronic
965849950 3:173010948-173010970 CAGGTCTTTTTTTGGTTGGTAGG - Intronic
966066511 3:175828044-175828066 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
966105369 3:176326781-176326803 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
966233044 3:177670549-177670571 GAGACGTTTCTTGGGCTGGTCGG + Intergenic
966270023 3:178093785-178093807 CAGGGCTTTTTTTGGTTGGTAGG - Intergenic
966278922 3:178207847-178207869 GAGATGTTCTTTGGGCTGGTTGG + Intergenic
966574202 3:181481139-181481161 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
966969957 3:185035110-185035132 TAGTACTTTTTTTGGTTGGTGGG - Intronic
967244455 3:187471462-187471484 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
967447915 3:189588376-189588398 GATACGTTAGGTTGGTTGGTTGG + Intergenic
967495945 3:190145097-190145119 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
968260083 3:197314480-197314502 CAGAGCTTTTTATGGTTGGTAGG + Intergenic
969654423 4:8488130-8488152 GAGATGTTTCTTGGGCTGGTTGG + Intronic
970070814 4:12157769-12157791 CTGGCCTTTTTTTGGTTGGTAGG + Intergenic
970210122 4:13700995-13701017 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
970864390 4:20742081-20742103 TGGACTTTTTTTTGGTTGGCAGG - Intronic
970917774 4:21355664-21355686 TAGACTTTTTCTTGGTTGGTAGG - Intronic
971180283 4:24323825-24323847 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
971199835 4:24501535-24501557 GAGATGTTTCTTGGGTTGGTCGG - Intergenic
971416076 4:26431255-26431277 CAGCTGTTTTGTTGGTTGGTTGG + Exonic
971561023 4:28079708-28079730 CTGGAGTTTTTTTGGTTGGTAGG - Intergenic
971679352 4:29676653-29676675 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
971739512 4:30502357-30502379 GAGTTGTTTTATTTGTTGGTCGG + Intergenic
971746200 4:30584602-30584624 GATATTTTTTTTTGGTTGGTAGG + Intergenic
971919022 4:32912409-32912431 AGGGCTTTTTTTTGGTTGGTAGG - Intergenic
972317527 4:37941152-37941174 CTGGCCTTTTTTTGGTTGGTAGG + Intronic
972830503 4:42809441-42809463 GAATCCTATTTTTGGTTGGTAGG + Intergenic
973137411 4:46725095-46725117 TGGACTTTTTTTTGTTTGGTAGG + Intergenic
973602356 4:52554521-52554543 GAGCAGCTTTTCTGGTTGGTTGG + Intergenic
973673948 4:53245119-53245141 CAGGCTTTTTTTTGGTTGGTAGG - Intronic
973967703 4:56180883-56180905 GAGAGGTTTTATTAGATGGTGGG + Intronic
974428672 4:61769411-61769433 GAGATGTTTCTTGGGCTGGTCGG + Intronic
975056017 4:69929779-69929801 TGGCCTTTTTTTTGGTTGGTAGG + Intergenic
975149083 4:71001616-71001638 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
975279685 4:72546680-72546702 TAAAGGTTTTTTTGGTTAGTAGG - Intronic
975304248 4:72830834-72830856 TGGACTTTTTTTTGCTTGGTAGG - Intergenic
975483860 4:74912844-74912866 GTGGACTTTTTTTGGTTGGTAGG + Intergenic
975490167 4:74979473-74979495 ATGAGCTTTTTTTGGTTGGTAGG - Intronic
975529029 4:75381617-75381639 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
975792678 4:77971533-77971555 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
975807137 4:78124603-78124625 TGGACTTTTTTTTGGTTGGTAGG + Intronic
976432870 4:84983306-84983328 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
976457936 4:85271254-85271276 CAGGACTTTTTTTGGTTGGTAGG - Intergenic
976532075 4:86167229-86167251 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
976537867 4:86239477-86239499 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
976619585 4:87114659-87114681 GACAGGTTTTTTGGGTTGTTTGG - Exonic
976884863 4:89969947-89969969 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
976992038 4:91379381-91379403 TGGACTTTTTTTTGGTTGGTAGG + Intronic
977001795 4:91513591-91513613 CAGGGCTTTTTTTGGTTGGTAGG + Intronic
977198691 4:94089655-94089677 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
977713704 4:100156710-100156732 GTGGGCTTTTTTTGGTTGGTAGG + Intergenic
977771419 4:100865436-100865458 CTGGAGTTTTTTTGGTTGGTAGG + Intronic
977813056 4:101380713-101380735 CAGAGCTTTTTTTGGTTGATAGG + Intergenic
978001403 4:103558911-103558933 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
978054433 4:104246091-104246113 TAGAGGTTTTTCTGGCTGGTAGG + Intergenic
978140238 4:105309869-105309891 TGGACTTTTTTTTGGTTTGTAGG + Intergenic
978140686 4:105314259-105314281 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
978205713 4:106078645-106078667 CAGGGCTTTTTTTGGTTGGTAGG - Intronic
978236590 4:106468182-106468204 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
978657162 4:111078065-111078087 TGGACTTTTTTTTGGTTGGCAGG - Intergenic
979220495 4:118218057-118218079 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
979379591 4:119994225-119994247 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
979421706 4:120512623-120512645 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
979561915 4:122110394-122110416 GCGCCGTTTTTTAAGTTGGTCGG - Intergenic
979583571 4:122388497-122388519 TGGACTTTTTTTTGGTTGGTAGG + Intronic
979895396 4:126149984-126150006 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
979911983 4:126378986-126379008 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
979925259 4:126555212-126555234 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
979953045 4:126919368-126919390 TGGACTTTTTTTTGGTTGATAGG - Intergenic
979998395 4:127460759-127460781 AAAAACTTTTTTTGGTTGGTAGG + Intergenic
980112230 4:128646068-128646090 GAGACGTTCCTTGGGCTGGTGGG + Intergenic
980261652 4:130457021-130457043 TAGGTTTTTTTTTGGTTGGTAGG + Intergenic
980284683 4:130767920-130767942 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
980317322 4:131219063-131219085 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
980333326 4:131437690-131437712 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
980344512 4:131596024-131596046 AAGACTTGTTTTTGTTTGGTGGG - Intergenic
980527600 4:134012730-134012752 GAGACGTTTCTTGGGCTGGTTGG - Intergenic
980584386 4:134793091-134793113 TAGACTTTTTTTTACTTGGTAGG - Intergenic
980903621 4:138928345-138928367 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
981068650 4:140511704-140511726 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
981255072 4:142651733-142651755 TGGACTTTTTTTTGGTTGGTAGG - Intronic
981524846 4:145699381-145699403 GAGATGTTTCTTGGGCTGGTCGG - Intronic
981539404 4:145833119-145833141 GAGATGTTTCTTGGGCTGGTCGG - Intronic
981810009 4:148763252-148763274 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
981851116 4:149231336-149231358 CTGGAGTTTTTTTGGTTGGTAGG - Intergenic
982059900 4:151594371-151594393 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
982393933 4:154895474-154895496 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
982414485 4:155113655-155113677 GAGATGTTTTTTGGGCTGGTTGG + Intergenic
982502030 4:156169475-156169497 GAGAAGTTTGTTAGGTTGGCTGG - Intergenic
982826051 4:160005186-160005208 TGGACTTTATTTTGGTTGGTAGG - Intergenic
982874163 4:160624678-160624700 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
983023586 4:162709693-162709715 GAGATGTTTCTTGGGCTGGTGGG - Intergenic
983055209 4:163093712-163093734 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
983360095 4:166716685-166716707 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
983447782 4:167876818-167876840 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
983659295 4:170116947-170116969 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
983707427 4:170678154-170678176 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
983754139 4:171312786-171312808 CTGGCCTTTTTTTGGTTGGTAGG + Intergenic
983774607 4:171591692-171591714 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
984165602 4:176299869-176299891 GAGATGTTCTTTGGGCTGGTCGG + Intergenic
984393883 4:179169988-179170010 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
984403823 4:179301445-179301467 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
984700326 4:182814851-182814873 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
985225523 4:187756563-187756585 GATTTTTTTTTTTGGTTGGTAGG + Intergenic
985435452 4:189926402-189926424 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1202759145 4_GL000008v2_random:93898-93920 CAGGACTTTTTTTGGTTGGTAGG + Intergenic
985581980 5:703009-703031 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
986193246 5:5516082-5516104 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
986490455 5:8284181-8284203 TGGACTTTTTTTTGGATGGTAGG - Intergenic
986625496 5:9720208-9720230 CAGAGATTTTTGTGGTTGGTTGG - Intergenic
986905499 5:12490430-12490452 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
986988647 5:13526694-13526716 GAGAGGTTTTCTAGGTTGTTAGG + Intergenic
987415739 5:17660208-17660230 TGGGCCTTTTTTTGGTTGGTAGG + Intergenic
987498417 5:18674021-18674043 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
987534851 5:19171742-19171764 CAGACTTTTTTTTGGTTTGTCGG + Intergenic
987606067 5:20137825-20137847 TGGACTTTTTTTTGGTTGGTAGG - Intronic
987648993 5:20716028-20716050 CAGGGCTTTTTTTGGTTGGTAGG + Intergenic
988070958 5:26287433-26287455 TGGACTTTTTTCTGGTTGGTAGG - Intergenic
988290124 5:29273791-29273813 CAGGCTTTTTTTTGCTTGGTAGG - Intergenic
988402416 5:30778930-30778952 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
988667957 5:33350791-33350813 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
988746574 5:34145500-34145522 CAGGGCTTTTTTTGGTTGGTAGG - Intergenic
989194525 5:38703447-38703469 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
989607925 5:43263238-43263260 CTGAACTTTTTTTGGTTGGTAGG + Intronic
989614442 5:43325517-43325539 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
989692982 5:44167691-44167713 CAGAGCTTTTTCTGGTTGGTAGG + Intergenic
989768929 5:45119375-45119397 GTGGACTTTTTTTGGTTGGTAGG - Intergenic
990360141 5:55010506-55010528 CTGGCCTTTTTTTGGTTGGTAGG - Intronic
990782001 5:59375550-59375572 CTGGGGTTTTTTTGGTTGGTAGG - Intronic
991110419 5:62893508-62893530 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
991232571 5:64352031-64352053 TGGACTTTTTTTTTGTTGGTAGG + Intronic
991363988 5:65849519-65849541 GACTTTTTTTTTTGGTTGGTAGG + Intronic
991553438 5:67868612-67868634 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
991900104 5:71452240-71452262 GAGACGGTTTTTTGCCTTGTTGG + Intergenic
992078196 5:73210573-73210595 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
992220818 5:74570951-74570973 AGGGCTTTTTTTTGGTTGGTAGG + Intergenic
992254478 5:74907869-74907891 CTGGCCTTTTTTTGGTTGGTAGG + Intergenic
993008466 5:82453870-82453892 GTGGACTTTTTTTGGTTGGTAGG + Intergenic
993242821 5:85412991-85413013 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
993403804 5:87486242-87486264 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
993438003 5:87921609-87921631 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
993591874 5:89804407-89804429 GATTTTTTTTTTTGGTTGGTAGG - Intergenic
993763374 5:91824684-91824706 GACAAGTTTTTTTGGAGGGTTGG + Intergenic
993911873 5:93693566-93693588 GACTTTTTTTTTTGGTTGGTAGG - Intronic
993946499 5:94122399-94122421 GAGACTTTTTTGTGGGGGGTGGG - Intergenic
994015362 5:94958782-94958804 CATGGGTTTTTTTGGTTGGTAGG - Intronic
994143241 5:96364452-96364474 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
994299101 5:98124894-98124916 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
994510954 5:100703185-100703207 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
994861477 5:105201315-105201337 TGGACTTTTTTTTGGTTGTTAGG - Intergenic
995062693 5:107828433-107828455 AAGGGGTTTTTTTGTTTGGTTGG + Intergenic
995258004 5:110069582-110069604 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
995270221 5:110211572-110211594 GACTTTTTTTTTTGGTTGGTGGG + Intergenic
995296594 5:110531436-110531458 GAGATGTTTCTTGGGCTGGTCGG - Intronic
995516589 5:112960287-112960309 GAGAAGTTTTTTTGTTTGTTTGG + Intergenic
995666051 5:114544132-114544154 ATGAAGTTTTTTTGGTTAGTAGG - Intergenic
995711727 5:115042460-115042482 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
995715081 5:115074508-115074530 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
995960287 5:117830437-117830459 ATGAAGTTTTTTTGGTTAGTAGG + Intergenic
996036557 5:118764935-118764957 GGGCTTTTTTTTTGGTTGGTGGG - Intergenic
996345066 5:122478602-122478624 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
996527772 5:124497553-124497575 GAGACGTTTCTTGGGCTGGTGGG - Intergenic
996592590 5:125164200-125164222 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
996778228 5:127156178-127156200 GGGCCTTTTTTTTGGTTGGTTGG + Intergenic
996878645 5:128268386-128268408 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
996894153 5:128459313-128459335 CTGAGGTTTTTTTGGTTGGTAGG - Intronic
997108658 5:131049737-131049759 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
997171499 5:131726324-131726346 TGGACTTTTTTTTGGTTGGCAGG + Intronic
997578341 5:135000549-135000571 CTGGAGTTTTTTTGGTTGGTAGG + Intronic
997620248 5:135284563-135284585 AGGGCATTTTTTTGGTTGGTAGG + Intronic
997746134 5:136301943-136301965 GAGATGTTTCTTGGGCTGGTCGG - Intronic
997903075 5:137786448-137786470 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
998685077 5:144515172-144515194 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
998691254 5:144591073-144591095 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
998703818 5:144735912-144735934 CTGAGGCTTTTTTGGTTGGTAGG + Intergenic
998779822 5:145644142-145644164 CTGAACTTTTTTTGGTTGGTAGG + Intronic
998996655 5:147873946-147873968 GAGATGTTTCTTGGGCTGGTTGG + Intronic
999111186 5:149122773-149122795 GAGACTTTTTTGTTGTTGTTAGG - Intergenic
999467152 5:151818176-151818198 TAGAGAATTTTTTGGTTGGTTGG + Intergenic
999612035 5:153380404-153380426 GAGATGATTTTTTGGTTGTCAGG + Intergenic
999965940 5:156809664-156809686 CTGGAGTTTTTTTGGTTGGTAGG - Intergenic
1000214593 5:159143037-159143059 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
1000521812 5:162304688-162304710 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1000700399 5:164442566-164442588 GTGTGTTTTTTTTGGTTGGTTGG - Intergenic
1000748940 5:165070958-165070980 GGGCATTTTTTTTGGTTGGTAGG + Intergenic
1001346062 5:170900147-170900169 GGGCTTTTTTTTTGGTTGGTAGG + Intronic
1002611266 5:180419941-180419963 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1002734481 5:181374194-181374216 TGGACTGTTTTTTGGTTGGTAGG + Intergenic
1002750054 6:99930-99952 TGGACTGTTTTTTGGTTGGTAGG - Intergenic
1003496864 6:6671673-6671695 TGGACTTTTTTTTTGTTGGTAGG - Intergenic
1003560971 6:7180021-7180043 TAGATGTTTTTTTGGGGGGTGGG + Intronic
1003817405 6:9857553-9857575 GAGACTTTTCTTTGATTGGAAGG - Intronic
1004105912 6:12667690-12667712 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1004508320 6:16264357-16264379 GAGATGTTTCTTGGGCTGGTCGG + Intronic
1004717462 6:18231726-18231748 CTGAACTTTTTTTGGTTGGTAGG - Intronic
1004768888 6:18759348-18759370 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1004836744 6:19539545-19539567 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1005014956 6:21366685-21366707 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1005182553 6:23122594-23122616 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1005393312 6:25355693-25355715 GAGAGGTTTCTTTGGTTGGTTGG - Intronic
1005544720 6:26853748-26853770 CAGGGCTTTTTTTGGTTGGTAGG - Intergenic
1006999155 6:38292446-38292468 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
1008424901 6:51345907-51345929 TAGGCTTTGTTTTGGTTGGTAGG + Intergenic
1008758047 6:54821292-54821314 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
1008998167 6:57682999-57683021 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1009015510 6:57895381-57895403 CAGGGCTTTTTTTGGTTGGTAGG - Intergenic
1009186665 6:60582363-60582385 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1009279246 6:61725806-61725828 CTGAGATTTTTTTGGTTGGTGGG - Intronic
1009429502 6:63550602-63550624 GATATTTGTTTTTGGTTGGTTGG + Intronic
1009521463 6:64687850-64687872 TGGAATTTTTTTTGGTTGGTAGG + Intronic
1009580941 6:65533345-65533367 TGGACTTTTTTTTGGTTGGTAGG - Intronic
1009668297 6:66711025-66711047 CTGATCTTTTTTTGGTTGGTAGG + Intergenic
1010043840 6:71419284-71419306 GAAAACTTTTTTTGGTTGGGGGG - Intergenic
1010105320 6:72161015-72161037 GACTTTTTTTTTTGGTTGGTAGG + Intronic
1010334706 6:74666858-74666880 GAGACAAATTTTTGTTTGGTTGG - Intergenic
1010473304 6:76256067-76256089 CAGGGCTTTTTTTGGTTGGTAGG + Intergenic
1010520368 6:76824881-76824903 GAGCATTTTTTTTGGTTGGTAGG + Intergenic
1010887098 6:81257471-81257493 CGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1011053247 6:83177422-83177444 GAGAGGTTTTCTGGGGTGGTGGG - Intronic
1011062287 6:83284246-83284268 GGGGGATTTTTTTGGTTGGTAGG - Intronic
1011142910 6:84179855-84179877 TGTACTTTTTTTTGGTTGGTAGG - Intronic
1011229841 6:85148233-85148255 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1011234912 6:85205499-85205521 TGGACTTTTTTTTGTTTGGTAGG - Intergenic
1011301149 6:85875548-85875570 CAGACTTTTTTTTTGTTGTTAGG + Intergenic
1011324370 6:86133129-86133151 TGGTCGTTTTTTTGGTTGGAAGG + Intergenic
1011336695 6:86269164-86269186 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
1012066809 6:94559006-94559028 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1012155745 6:95818001-95818023 TAGGCTTTTTTTTAGTTGGTAGG - Intergenic
1012234541 6:96798220-96798242 GAGACTTTTTTTTGGTTTTGGGG - Exonic
1012315516 6:97780057-97780079 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1012514431 6:100042267-100042289 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1012687125 6:102266093-102266115 GGGCTTTTTTTTTGGTTGGTTGG - Intergenic
1012689246 6:102293268-102293290 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1012745175 6:103077777-103077799 AAGATTTTTTTTTGGTTGGAGGG - Intergenic
1012888535 6:104873147-104873169 TGGACTTTTTTTTGGTTGGCAGG + Intergenic
1013124198 6:107167107-107167129 TGGACTTTTTTTTGGTTGGTAGG + Intronic
1013200392 6:107889220-107889242 TGGACTTTTTTTTGGTTGGTAGG + Intronic
1013625344 6:111931619-111931641 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1013652259 6:112207533-112207555 GGGATGTTTGTTTGTTTGGTTGG - Intronic
1013708554 6:112870309-112870331 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
1014004590 6:116403647-116403669 GAGGGGTTTGGTTGGTTGGTTGG + Intronic
1014332431 6:120086474-120086496 TGGACGTTTTTTTGGTTGGTAGG - Intergenic
1014347729 6:120295172-120295194 TGGACGTTTTTTTGGTTGGTAGG + Intergenic
1014395709 6:120925344-120925366 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1014431098 6:121371757-121371779 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
1014560323 6:122881934-122881956 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
1014868538 6:126561955-126561977 CGGACTTTTTTTTGGTTAGTAGG - Intergenic
1014891277 6:126849384-126849406 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1015131055 6:129809651-129809673 TGGACTTTTTTTTGGGTGGTAGG + Intergenic
1015164918 6:130192820-130192842 GAGATGTTTCTTGGGCTGGTTGG - Intronic
1015200096 6:130569951-130569973 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1015271062 6:131339360-131339382 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1016111783 6:140233601-140233623 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
1016114420 6:140262538-140262560 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1016160103 6:140869284-140869306 CTGGAGTTTTTTTGGTTGGTAGG - Intergenic
1016204253 6:141453334-141453356 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1016242180 6:141943644-141943666 GGGATTTTTTTTTGGTTGGTAGG - Intergenic
1016333590 6:142979992-142980014 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
1016552787 6:145300219-145300241 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
1016650655 6:146455906-146455928 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1016663468 6:146608026-146608048 CAGAGTTTTTTCTGGTTGGTAGG + Intronic
1016748106 6:147602772-147602794 GAGTTTTTTTTTTGTTTGGTTGG - Intronic
1016852976 6:148640289-148640311 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1017779643 6:157705955-157705977 GAGATGTTTCTTGGGCTGGTTGG + Intronic
1018084803 6:160291781-160291803 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1018179010 6:161203851-161203873 TAGAGTTTTTGTTGGTTGGTTGG + Intronic
1018495761 6:164344240-164344262 GAGATGTTTCTTGGGCTGGTGGG + Intergenic
1019038333 6:169082095-169082117 GTGTCTTATTTTTGGTTGGTTGG - Intergenic
1020358104 7:7299775-7299797 TGGGCCTTTTTTTGGTTGGTAGG + Intergenic
1020533007 7:9358625-9358647 GAGATGTTCTTTGGGCTGGTCGG + Intergenic
1020541395 7:9463633-9463655 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1020703260 7:11510286-11510308 CAGGACTTTTTTTGGTTGGTAGG - Intronic
1020716357 7:11678709-11678731 TAGGCATTTTTTTGGTTGGTAGG - Intronic
1020885323 7:13813065-13813087 TAGGCTTTTTTTTTGTTGGTAGG - Intergenic
1020935739 7:14461616-14461638 TAGGCTTTTTTTTGGTTTGTAGG - Intronic
1021172446 7:17414591-17414613 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1021202037 7:17738200-17738222 CAGAACTTTTTTTGGTTGGTAGG - Intergenic
1021520329 7:21533408-21533430 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
1021967493 7:25935441-25935463 GGGATTTTTTTTTGGTTGGCAGG - Intergenic
1022372605 7:29785499-29785521 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1022885212 7:34636385-34636407 CTGTGGTTTTTTTGGTTGGTAGG - Intergenic
1023650900 7:42368065-42368087 TGGACTGTTTTTTGGTTGGTAGG + Intergenic
1023699183 7:42875792-42875814 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1024016300 7:45318779-45318801 CTGGAGTTTTTTTGGTTGGTAGG - Intergenic
1024153257 7:46594405-46594427 TGGACTTCTTTTTGGTTGGTAGG - Intergenic
1024697302 7:51870440-51870462 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1024892662 7:54221612-54221634 TGGACTTTTTTTTGGTTGGCAGG - Intergenic
1024899442 7:54301588-54301610 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
1024901254 7:54320775-54320797 TGGACTTTTTTTTGGTTGGCAGG + Intergenic
1024986461 7:55198129-55198151 TAGGCTTTGTTTTGGTTGGTAGG + Intronic
1025037082 7:55601264-55601286 CAGAGCTCTTTTTGGTTGGTAGG - Intergenic
1026022367 7:66719175-66719197 GTGATGTTGTTTTTGTTGGTTGG - Intronic
1026886796 7:73954488-73954510 GTGATGTTGTTTTTGTTGGTTGG - Intergenic
1027731589 7:81881202-81881224 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
1027923149 7:84422146-84422168 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
1028019679 7:85754664-85754686 GGGTTTTTTTTTTGGTTGGTAGG - Intergenic
1028218017 7:88159267-88159289 TGGCCTTTTTTTTGGTTGGTAGG - Intronic
1028526569 7:91793081-91793103 CTGGCCTTTTTTTGGTTGGTAGG - Intronic
1028652540 7:93167068-93167090 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1028767320 7:94574357-94574379 CAGGGCTTTTTTTGGTTGGTAGG + Intergenic
1028785151 7:94784307-94784329 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1028802681 7:94984460-94984482 TCGGAGTTTTTTTGGTTGGTAGG + Intronic
1029932977 7:104392816-104392838 TGGACTTTTCTTTGGTTGGTAGG + Intronic
1030126091 7:106153763-106153785 GCCTTGTTTTTTTGGTTGGTTGG - Intergenic
1030200640 7:106899983-106900005 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
1030438501 7:109555449-109555471 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
1030441938 7:109597057-109597079 GAAACGTTTCTTGGGCTGGTCGG + Intergenic
1030751791 7:113238708-113238730 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1030813257 7:114002840-114002862 GAGCTTTTTTTTTGATTGGTAGG - Intronic
1030882241 7:114894618-114894640 TAGGCTTTTTTTTGGTTGGTAGG + Intergenic
1031254606 7:119431641-119431663 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
1031355500 7:120782354-120782376 GAGATGTTCCTTGGGTTGGTGGG + Intergenic
1031365033 7:120890852-120890874 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1031391762 7:121223588-121223610 TGGACTTTTTTTTGGTTGGTAGG + Intronic
1031399647 7:121315927-121315949 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1031422734 7:121569138-121569160 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1031612248 7:123841622-123841644 TGGACTTTTTTTTGGTTGGTAGG + Intronic
1031641870 7:124174324-124174346 TGGAATTTTTTTTGGTTGGTAGG + Intergenic
1031728213 7:125264059-125264081 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1031811069 7:126369660-126369682 CAGGACTTTTTTTGGTTGGTAGG - Intergenic
1031904812 7:127448809-127448831 CAGGGCTTTTTTTGGTTGGTAGG - Intergenic
1031924426 7:127625370-127625392 GAGGTTTTTGTTTGGTTGGTTGG + Intergenic
1032031106 7:128484561-128484583 CAGTGGTTTTTTTGTTTGGTTGG + Intronic
1032250388 7:130251652-130251674 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1032646745 7:133833549-133833571 CACACTTTTGTTTGGTTGGTTGG + Intronic
1033103391 7:138497207-138497229 GGGAAGGTTTTTTGTTTGGTTGG + Intronic
1033239335 7:139664149-139664171 GAGATATTTGGTTGGTTGGTTGG - Intronic
1033522873 7:142179985-142180007 AGGACTTTTTTTTGGTTGGTGGG + Intronic
1033677947 7:143562456-143562478 GAGAAGTTTTTTTGGGGGGAGGG - Intergenic
1033693889 7:143766981-143767003 GAGAAGTTTTTTTGGGGGGAGGG + Intergenic
1033768456 7:144521754-144521776 GAGAAGCTTTGTTGGTGGGTTGG + Intronic
1034314813 7:150120597-150120619 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
1034499691 7:151441348-151441370 GAGAAGTTTTCTGGGTTGGCTGG - Intergenic
1034722324 7:153305705-153305727 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
1034792085 7:153980174-153980196 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
1035026045 7:155826949-155826971 GGGGGGTTTTTTTGTTTGGTTGG - Intergenic
1035087705 7:156275299-156275321 GATACGGTTTTTTGGTGGGGAGG + Intergenic
1035509038 8:160098-160120 TGGACTGTTTTTTGGTTGGTAGG - Intergenic
1035598864 8:882884-882906 GCGACGTTGTTTTGTTGGGTCGG + Intergenic
1036639168 8:10571591-10571613 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1037030365 8:14096733-14096755 CAGAACTTTTTTTGGTTGGTAGG + Intronic
1037545148 8:19912633-19912655 TGGATTTTTTTTTGGTTGGTAGG + Intronic
1037626731 8:20614449-20614471 TGGACTTTTATTTGGTTGGTAGG + Intergenic
1037685470 8:21135594-21135616 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1037783610 8:21888590-21888612 GAGAGATTTTTTAGGATGGTTGG + Intergenic
1037999198 8:23376568-23376590 CTGGCCTTTTTTTGGTTGGTAGG + Intronic
1038609945 8:29051360-29051382 GGGAAGTTTGGTTGGTTGGTTGG - Exonic
1039265519 8:35819499-35819521 GAGGGCTTTTTTTGGTTGGTAGG - Intergenic
1039577739 8:38637779-38637801 AGGTCTTTTTTTTGGTTGGTAGG + Intergenic
1040519776 8:48165994-48166016 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1041051129 8:53935617-53935639 TGGGCCTTTTTTTGGTTGGTAGG - Intronic
1041275061 8:56148772-56148794 CTGAACTTTTTTTGGTTGGTTGG + Intergenic
1041293980 8:56335390-56335412 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1041560413 8:59211481-59211503 CAGAACTTTTTTTGGTTGCTGGG + Intergenic
1041891461 8:62874343-62874365 CTGGGGTTTTTTTGGTTGGTAGG - Intronic
1042108341 8:65352720-65352742 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1042111253 8:65383454-65383476 GACTTTTTTTTTTGGTTGGTAGG - Intergenic
1042394818 8:68279793-68279815 TAGACTTTTTTTTGGTTGGTAGG - Intergenic
1042433653 8:68738797-68738819 CTGGCCTTTTTTTGGTTGGTAGG - Intronic
1042489827 8:69384592-69384614 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1042534664 8:69846785-69846807 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1042636311 8:70879670-70879692 GCGCTTTTTTTTTGGTTGGTAGG - Intergenic
1043324862 8:79037422-79037444 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1043546586 8:81322328-81322350 GAGAGGTTTTCTGGGTTGGCAGG - Intergenic
1043579525 8:81696066-81696088 TAAACGTTTGGTTGGTTGGTTGG - Exonic
1043617606 8:82146000-82146022 TGGACTTTTTTTTGGTTGTTAGG + Intergenic
1043700464 8:83281179-83281201 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
1043761349 8:84072404-84072426 CAGGAGTTTATTTGGTTGGTAGG + Intergenic
1043837412 8:85063348-85063370 GAGAGGTTTCTTGGGCTGGTTGG - Intergenic
1043845146 8:85154786-85154808 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1044073530 8:87790930-87790952 GAGGCTTTTTTTTAGATGGTAGG - Intergenic
1044102806 8:88161176-88161198 CTGGAGTTTTTTTGGTTGGTAGG + Intronic
1044148778 8:88747292-88747314 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1044214163 8:89587882-89587904 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
1044222159 8:89681867-89681889 GTTTTGTTTTTTTGGTTGGTAGG - Intergenic
1044258883 8:90095305-90095327 GAGATGTTTCTTGGGCTGGTCGG + Intronic
1044364515 8:91327104-91327126 TAGACTTTTTTTTGGTGGGGAGG + Intronic
1044384448 8:91570791-91570813 TGGGCTTTTTTTTGGTTGGTAGG - Intergenic
1044416784 8:91948535-91948557 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1044486760 8:92763566-92763588 TGGACTTTTTTTTTGTTGGTAGG - Intergenic
1044687360 8:94839909-94839931 GAGAGGTTTTTTTGTTTTTTGGG - Intronic
1044808753 8:96035742-96035764 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1044905857 8:97001895-97001917 TTGAGCTTTTTTTGGTTGGTAGG + Intronic
1044924834 8:97201330-97201352 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1045612003 8:103854987-103855009 CAGGGCTTTTTTTGGTTGGTAGG + Intronic
1045644493 8:104286449-104286471 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1046067658 8:109215657-109215679 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1046344633 8:112906458-112906480 GAGACGTTTTTTTGGTTGGTTGG - Intronic
1046439773 8:114242164-114242186 GAGATGTTCTTTGGGCTGGTCGG - Intergenic
1046608220 8:116394249-116394271 CTGCAGTTTTTTTGGTTGGTGGG - Intergenic
1046672567 8:117072795-117072817 GAGCAGTTTTTTTCTTTGGTAGG - Intronic
1046887172 8:119380168-119380190 TGGACTTTTTTTTAGTTGGTAGG - Intergenic
1047575732 8:126152914-126152936 CAGGGCTTTTTTTGGTTGGTAGG - Intergenic
1047699056 8:127432257-127432279 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1048135192 8:131741261-131741283 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1048428999 8:134350879-134350901 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1048585739 8:135772450-135772472 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1048614867 8:136062671-136062693 CAGAGCTTTTTTTGGTTGGTAGG - Intergenic
1048739431 8:137538156-137538178 GAGACTTTTATTTGTTTGGGGGG - Intergenic
1049136396 8:140904627-140904649 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
1049871976 8:144986883-144986905 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1049968233 9:798502-798524 CAGAGGTTTACTTGGTTGGTTGG - Intergenic
1050129840 9:2400338-2400360 CGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1050258369 9:3816235-3816257 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1050497583 9:6260646-6260668 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1050720975 9:8589218-8589240 AAGATGCTTGTTTGGTTGGTGGG - Intronic
1050864047 9:10475495-10475517 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
1050963715 9:11769718-11769740 GGTCCTTTTTTTTGGTTGGTAGG - Intergenic
1051076392 9:13242642-13242664 AAGATGTTTTATTTGTTGGTTGG - Intronic
1051113190 9:13663631-13663653 TGGACTTTCTTTTGGTTGGTAGG - Intergenic
1051238677 9:15028699-15028721 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1051373550 9:16380365-16380387 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1051451369 9:17201464-17201486 TGGGCTTTTTTTTGGTTGGTAGG + Intronic
1051571156 9:18560636-18560658 GGGTTTTTTTTTTGGTTGGTAGG + Intronic
1051962597 9:22786334-22786356 TTGGCTTTTTTTTGGTTGGTAGG + Intergenic
1052017907 9:23490755-23490777 TAGGCCTTTTTTTGGTTGGTGGG - Intergenic
1052078883 9:24178952-24178974 CTGAGGTTTTTTTGGTCGGTAGG + Intergenic
1052134400 9:24892234-24892256 GACTTTTTTTTTTGGTTGGTAGG - Intergenic
1052382013 9:27781848-27781870 GCGCTTTTTTTTTGGTTGGTAGG + Intergenic
1052520009 9:29534693-29534715 CAGAGTTTTTTCTGGTTGGTAGG - Intergenic
1052667694 9:31516004-31516026 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
1052696520 9:31885786-31885808 CTGAACTTTTTTTGGTTGGTAGG + Intergenic
1053041941 9:34881723-34881745 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1053613443 9:39739500-39739522 CAGCTGTTTTGTTGGTTGGTTGG - Intergenic
1053622778 9:39837282-39837304 CTGAGCTTTTTTTGGTTGGTAGG - Intergenic
1053871485 9:42497457-42497479 CAGCTGTTTTGTTGGTTGGTTGG - Intergenic
1054240071 9:62602897-62602919 CAGCTGTTTTGTTGGTTGGTTGG + Intergenic
1054554204 9:66637423-66637445 CAGCTGTTTTGTTGGTTGGTTGG + Intergenic
1055338393 9:75256319-75256341 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
1055342790 9:75302845-75302867 AGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1055523145 9:77102747-77102769 CTGGCCTTTTTTTGGTTGGTAGG - Intergenic
1055626403 9:78181212-78181234 GAGATGTTTCTTTGGCTGGTTGG - Intergenic
1055675876 9:78660119-78660141 CAGGGGTTTTTTTGGTTGGCAGG + Intergenic
1055895145 9:81165944-81165966 CAGGACTTTTTTTGGTTGGTAGG - Intergenic
1056045003 9:82705717-82705739 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1056060875 9:82884293-82884315 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1056323527 9:85458883-85458905 GAGATGTTTCTTGGGCTGGTTGG - Intergenic
1056522105 9:87411256-87411278 GAGACGTTTCTTGGGCTGGTCGG - Intergenic
1056882726 9:90413254-90413276 GAGATGTTTATTGGGCTGGTCGG - Intergenic
1057136490 9:92692644-92692666 GAGATGTTTTTTTTGCTGGGAGG + Intergenic
1057234554 9:93348148-93348170 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1057377700 9:94540407-94540429 GAGATGTTTCTTGGGCTGGTGGG - Intergenic
1057582349 9:96298631-96298653 GAAAGGATTGTTTGGTTGGTGGG + Intronic
1057683653 9:97215075-97215097 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1057697685 9:97337793-97337815 TGGACATTTTTCTGGTTGGTAGG + Intronic
1058074255 9:100634521-100634543 GACCTTTTTTTTTGGTTGGTAGG + Intergenic
1058081652 9:100707111-100707133 CTGGAGTTTTTTTGGTTGGTAGG + Intergenic
1058386250 9:104439473-104439495 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1058612137 9:106788790-106788812 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1059318360 9:113446521-113446543 AAGACGTTTCTTTGGTTGTGGGG - Intronic
1059546432 9:115179794-115179816 GAGATGTTTCTTGGGCTGGTCGG + Intronic
1059863764 9:118490816-118490838 GAGATGTTCTTTGGGCTGGTCGG + Intergenic
1060133636 9:121130259-121130281 CTGGAGTTTTTTTGGTTGGTAGG + Intronic
1060225869 9:121790560-121790582 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1060738190 9:126079885-126079907 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1062758934 9:138326801-138326823 TGGACTGTTTTTTGGTTGGTAGG + Intergenic
1203539926 Un_KI270743v1:78797-78819 CAGGACTTTTTTTGGTTGGTAGG + Intergenic
1185868429 X:3643113-3643135 GAAATGTTTTTTTGGGGGGTGGG - Intronic
1185875236 X:3696721-3696743 CAGACTTTTTTTTGTTTGGCTGG + Intronic
1186046657 X:5544073-5544095 CAGACATTTTTTTGGGGGGTGGG + Intergenic
1186113181 X:6277397-6277419 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1186531565 X:10301455-10301477 GTGAAGTTTTTTTGTTTTGTTGG - Intergenic
1186783783 X:12940386-12940408 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1187074619 X:15921650-15921672 GGGTTGTTTGTTTGGTTGGTTGG - Intergenic
1187100183 X:16183897-16183919 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1187801785 X:23071802-23071824 GAGGGCTTTTTTTGGTTGGTAGG - Intergenic
1187828846 X:23360277-23360299 TGGACTTTTTTTTGCTTGGTAGG + Intronic
1187858917 X:23663691-23663713 GAATGGTTTTGTTGGTTGGTTGG + Intergenic
1187964623 X:24598816-24598838 AAGACATTTTCTTGGTTTGTAGG + Intronic
1188806673 X:34599074-34599096 AAGGGCTTTTTTTGGTTGGTAGG + Intergenic
1188848682 X:35105352-35105374 GAGGGCTTTTTTTGGTCGGTAGG - Intergenic
1189469919 X:41305846-41305868 GAGGGGTTTTTTTGGTGGGGGGG + Intergenic
1189734260 X:44053455-44053477 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
1189930175 X:46000950-46000972 GTGGACTTTTTTTGGTTGGTAGG + Intergenic
1190523770 X:51307617-51307639 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1190959443 X:55230960-55230982 CAGAGCATTTTTTGGTTGGTAGG - Intronic
1190977426 X:55419735-55419757 CTGGGGTTTTTTTGGTTGGTAGG - Intergenic
1191012136 X:55771533-55771555 CTGGCCTTTTTTTGGTTGGTAGG + Intergenic
1191122189 X:56917763-56917785 TAGACTTTTTTTTGGTTGGTAGG + Intergenic
1191124185 X:56936791-56936813 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1191135080 X:57055378-57055400 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1191160556 X:57325468-57325490 CTGAACTTTTTTTGGTTGGTAGG + Intronic
1191209136 X:57866654-57866676 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1191582776 X:62783321-62783343 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1191733777 X:64367120-64367142 TGGACTTTTTTTTGGTTGATAGG - Intronic
1191738552 X:64413167-64413189 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1191788373 X:64942021-64942043 TGGACTTTTTTTTGGTTGGTAGG + Intronic
1191824488 X:65349865-65349887 TGGACTTTTTTTTGGTTGTTAGG - Intergenic
1191931097 X:66373938-66373960 GGGCTTTTTTTTTGGTTGGTAGG + Intergenic
1191965921 X:66757985-66758007 GAGTCTTTTTGTTTGTTGGTTGG + Intergenic
1192396200 X:70783838-70783860 TGGACTTTTTTTTGGTTGGTAGG - Intronic
1192613216 X:72588940-72588962 TGGACTTTTTTTTGGTTGGTAGG - Intronic
1192710234 X:73574556-73574578 TTGAGCTTTTTTTGGTTGGTTGG + Intronic
1193005462 X:76613900-76613922 TCGGCTTTTTTTTGGTTGGTAGG - Intergenic
1193514681 X:82448885-82448907 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
1193581105 X:83263932-83263954 TGGACTTTTTTCTGGTTGGTGGG - Intergenic
1193625023 X:83808134-83808156 AGAACTTTTTTTTGGTTGGTAGG + Intergenic
1193634254 X:83928807-83928829 GGGATTTTTTTTTGGTTGGTAGG - Intergenic
1193697570 X:84727381-84727403 CAGGGCTTTTTTTGGTTGGTAGG + Intergenic
1193714064 X:84916658-84916680 GGGGATTTTTTTTGGTTGGTAGG - Intergenic
1193941169 X:87682239-87682261 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1194186546 X:90778575-90778597 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1194287112 X:92023526-92023548 TGGGCTTTTTTTTGGTTGGTAGG - Intronic
1194293882 X:92105309-92105331 GAGATGTTTCTTGGGCTGGTCGG + Intronic
1194350991 X:92824990-92825012 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1194406108 X:93497617-93497639 TGGACTTTTTTTTGGCTGGTAGG - Intergenic
1194503282 X:94704045-94704067 GAGATGTTTCTTGGGCTGGTTGG + Intergenic
1194508769 X:94766220-94766242 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1194854406 X:98911573-98911595 GAGCTTTTTTTTTGGTTGATAGG + Intergenic
1194901103 X:99512637-99512659 CTGAGCTTTTTTTGGTTGGTAGG + Intergenic
1195148126 X:102038711-102038733 CTGGTGTTTTTTTGGTTGGTAGG - Intergenic
1195198556 X:102523452-102523474 GGGGTTTTTTTTTGGTTGGTAGG - Intergenic
1195332440 X:103814948-103814970 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1195728954 X:107946064-107946086 TGGACTTTGTTTTGGTTGGTAGG + Intergenic
1195908945 X:109870292-109870314 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1196299751 X:114040598-114040620 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1196325493 X:114397567-114397589 TGGACTTCTTTTTGGTTGGTAGG - Intergenic
1196533824 X:116817644-116817666 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1196572207 X:117279688-117279710 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1196774144 X:119322910-119322932 GAGATGTTTCTTGGGCTGGTCGG + Intergenic
1196830782 X:119773881-119773903 AATAGGTTTTTTTGGTGGGTAGG + Intergenic
1196927729 X:120650133-120650155 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1197064622 X:122222564-122222586 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1197133002 X:123026798-123026820 TGGGCTTTTTTTTGGTTGGTTGG + Intergenic
1197142069 X:123129024-123129046 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1197180581 X:123531636-123531658 CTGAGATTTTTTTGGTTGGTAGG + Intergenic
1197183832 X:123564119-123564141 GGGCTTTTTTTTTGGTTGGTAGG - Intergenic
1197672284 X:129291448-129291470 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
1197793418 X:130277843-130277865 GAGATGTTCTTTGGGCTGGTTGG - Intergenic
1198072463 X:133162868-133162890 CTGAACTTTTTTTGGTTGGTAGG - Intergenic
1198124070 X:133624672-133624694 TGGACTTTTTTTTGGTTGGTAGG - Intronic
1198293394 X:135260423-135260445 CTGGCCTTTTTTTGGTTGGTAGG + Intronic
1198306406 X:135388161-135388183 TGGACTTTTTTTTGGTTGGTAGG - Intergenic
1198360336 X:135889301-135889323 TCTGCGTTTTTTTGGTTGGTTGG - Intronic
1198598139 X:138259169-138259191 GAGATGTTTCTTGGGTTGGTCGG - Intergenic
1198654081 X:138894671-138894693 GACTTTTTTTTTTGGTTGGTAGG - Intronic
1198784154 X:140269508-140269530 TGGGCTTTTTTTTGGTTGGTAGG + Intergenic
1199253471 X:145691670-145691692 GGGCTTTTTTTTTGGTTGGTAGG + Intergenic
1199387570 X:147240857-147240879 GAGCCGGATTGTTGGTTGGTTGG - Intergenic
1199455494 X:148023336-148023358 GAGACATTTTTTTGATTAATTGG + Intronic
1199469514 X:148178744-148178766 CTGGGGTTTTTTTGGTTGGTAGG + Intergenic
1199576169 X:149316142-149316164 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1199667065 X:150105074-150105096 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1199911524 X:152292145-152292167 TGGACTTTTTTTTAGTTGGTAGG + Intronic
1199968217 X:152837925-152837947 CTGGCCTTTTTTTGGTTGGTAGG + Intronic
1200125862 X:153814481-153814503 GAGACTTTTTTTTGGGGGGGGGG - Intronic
1200371104 X:155725448-155725470 TGGACGTTTTTTTGGTTGGTGGG + Intergenic
1200659318 Y:5941670-5941692 GAGATGTTTCTTGGGCTGGTCGG - Intergenic
1200733752 Y:6771617-6771639 CAGGACTTTTTTTGGTTGGTAGG + Intergenic
1201371579 Y:13270036-13270058 AAGACTTTTTTTTAGTTGTTTGG + Intronic
1201581102 Y:15512828-15512850 GAGATGTTTCTTGGGGTGGTGGG - Intergenic
1201582838 Y:15528876-15528898 TGGACTTTTTTTTGGTTGGTCGG + Intergenic
1201625451 Y:16009855-16009877 TGGAATTTTTTTTGGTTGGTAGG + Intergenic
1201725022 Y:17141589-17141611 GAGATGTTCCTTTGGCTGGTTGG + Intergenic
1201956272 Y:19626771-19626793 TGGACTTTTTTTTGGTTGGTAGG + Intergenic
1201957639 Y:19643524-19643546 TGGAATTTTTTTTGGTTGGTAGG + Intergenic
1202057045 Y:20845313-20845335 TGGACTTTTTTTTGGCTGGTGGG + Intergenic