ID: 1046350974

View in Genome Browser
Species Human (GRCh38)
Location 8:113011727-113011749
Sequence TCATGCCAGTATAAGATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046350974 Original CRISPR TCATGCCAGTATAAGATTTA AGG (reversed) Intronic
900956796 1:5891248-5891270 TCCTCCCAAAATAAGATTTATGG + Intronic
907096954 1:51790741-51790763 ACATGCCAGTATAAGAGGCACGG + Intronic
910614992 1:89187571-89187593 TTAACCCAGTATCAGATTTATGG - Intronic
911473365 1:98346059-98346081 TCATGTCAGTCTCAGATTTAAGG + Intergenic
911604697 1:99890552-99890574 TGATGCCAATATAATTTTTAAGG + Intronic
912331297 1:108822386-108822408 TCATGCCAGTATACGAACGAGGG - Intronic
913393212 1:118337553-118337575 TCATGCCAGGATGAGAATGATGG + Intergenic
916335728 1:163669157-163669179 TCATGTCAGGATGAGATGTAAGG - Intergenic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
920968328 1:210720678-210720700 TGATGCCACTATATGATTAATGG - Intronic
923487003 1:234442981-234443003 TCAAGCCAGAATAAAAATTATGG + Intronic
924147599 1:241092485-241092507 TCATGCAAGAATAAGACTTATGG + Intronic
1069496303 10:68906459-68906481 TAATCCCATCATAAGATTTAAGG - Intronic
1072455516 10:95572043-95572065 TCTTGCTAGTATAACATTTAAGG + Intergenic
1073395997 10:103218040-103218062 TCACCACAGTGTAAGATTTAAGG - Intergenic
1074099998 10:110347443-110347465 TCATGGTTGTAGAAGATTTATGG - Intergenic
1077258172 11:1598706-1598728 TCATGCCAGTCTCAGCTTTCCGG + Intergenic
1078072875 11:8129736-8129758 TCAGACCAGTAAAAGATTTCAGG + Intronic
1079623764 11:22590330-22590352 TAATGCCAGTGTAAAATTTTAGG - Intergenic
1082678157 11:56134974-56134996 TCATTGCATTATAATATTTAGGG + Intergenic
1084806583 11:71583419-71583441 TCATGCCAGTCTCAGTTTTCTGG + Intronic
1092994170 12:13932657-13932679 TCTTTCCAGTACAAGCTTTAGGG - Intronic
1093549909 12:20396304-20396326 TCATGCCAGTAAAATGTTAATGG - Intronic
1093621447 12:21295244-21295266 TTATGGGAGTATAAGATATATGG + Intronic
1097506125 12:60474034-60474056 TCAGCCCAGTATAAAATATATGG + Intergenic
1098385890 12:69918134-69918156 TCATAAAAGTATCAGATTTATGG + Intronic
1099864858 12:88267144-88267166 CCATGCCAGTAAAAGACTTCAGG + Intergenic
1100075998 12:90784778-90784800 CCATGGCAGTAGAATATTTAAGG - Intergenic
1100571365 12:95845958-95845980 ACATTTCAGCATAAGATTTAGGG + Intergenic
1101578234 12:106017632-106017654 TCACCACAGTGTAAGATTTAAGG - Intergenic
1103269798 12:119663888-119663910 ACATTTCAGTGTAAGATTTAGGG - Intergenic
1106144104 13:27036474-27036496 TTTTGCCAGAATATGATTTAGGG - Intergenic
1114364684 14:22013631-22013653 CTATTCCAGTATAAGATTTGTGG + Intergenic
1115796817 14:36946514-36946536 TAATGCCATTGAAAGATTTAAGG - Intronic
1117847960 14:59933474-59933496 TTTTGCCAGTGTAAGATTGAAGG + Intronic
1120872550 14:89350934-89350956 TACTGTCAGTATAATATTTAAGG - Intronic
1123720540 15:23057269-23057291 TCATTTCATTATAAGATTTAGGG - Intergenic
1126459651 15:48901420-48901442 CTATGTCAGTATAAGAATTATGG + Intronic
1128288520 15:66458979-66459001 TCAGGTCAGAATGAGATTTAAGG + Intronic
1142017761 16:87760162-87760184 TCATGTCAGGATATAATTTAAGG - Intronic
1154278996 18:12983636-12983658 TTATGCAAGTATAAGTTATAAGG - Intronic
1162966553 19:14158957-14158979 TCATGCTAGTGTAAAATTTGAGG - Intronic
1165291821 19:34891723-34891745 TCCTGCCAGTCTAAGACTAATGG - Intergenic
926354257 2:12025269-12025291 TCACCACAGTGTAAGATTTAAGG - Intergenic
927396293 2:22655160-22655182 TCATGCTAGAATAAGACTTTGGG + Intergenic
930760133 2:55025033-55025055 TCATGCCACTTTTGGATTTAGGG - Intronic
936823282 2:116550762-116550784 TCCTGCCAGGATAATATTTGAGG + Intergenic
936865641 2:117073664-117073686 TCATGCCAGAATTTGATTAAAGG - Intergenic
937272962 2:120665905-120665927 TCATGCCTGTATCAGAGTTTTGG - Intergenic
937851577 2:126640698-126640720 TTAGCCAAGTATAAGATTTAAGG + Intergenic
946854212 2:223936721-223936743 TCATGCCTGTATAAAATATGTGG + Intronic
1169093897 20:2878966-2878988 TCATAGCAGTATAAAATATAAGG + Intronic
1174602277 20:51734357-51734379 TCATACAACTATCAGATTTAGGG + Intronic
1177435210 21:21043111-21043133 TCAAGCCACTATAAGATTTAGGG + Intronic
1177566166 21:22824320-22824342 TCATGCCAGTTTAATTATTATGG - Intergenic
1179093968 21:38294837-38294859 TCAAACCAGTAAAAGATTAATGG - Intronic
1183880696 22:40825891-40825913 TCACCACAGTGTAAGATTTAAGG + Exonic
951123261 3:18953570-18953592 TCATCAAAGTATAAGAATTATGG + Intergenic
955946816 3:64203356-64203378 TTATGCCAGTTTATGACTTAAGG + Intronic
964556814 3:157948960-157948982 ACATGCCAGTATATGTTTTCTGG + Intergenic
965616110 3:170594137-170594159 TTATGCCATTATAAGAAATAAGG + Intronic
968710568 4:2113445-2113467 ACATGCCATTATAATATTTCAGG + Intronic
969163787 4:5286332-5286354 TTATGGAAGTATAAGATCTATGG + Intronic
970738008 4:19197212-19197234 TCAAGCCAGTATGAGAATGAAGG + Intergenic
971240042 4:24880079-24880101 ACATGACTGTATAAGATTTTTGG - Intronic
976965485 4:91034897-91034919 TCATGCAATTAAAAGAATTAAGG - Intronic
977066050 4:92316909-92316931 TCATGCCAATTTCAGATCTAAGG + Intronic
980785909 4:137554668-137554690 TTATGGAAGTATAAGATTTTAGG - Intergenic
981800895 4:148654431-148654453 TCATGAAAGTATAATTTTTACGG - Intergenic
981863158 4:149381397-149381419 AGATGCCATTATAAGATTTTTGG - Intergenic
982905564 4:161065460-161065482 TCATGACAGTTTAACATTTCTGG + Intergenic
984082297 4:175262417-175262439 AGATGCAAGTATAAGATTTCTGG + Intergenic
985124536 4:186679671-186679693 TCATGACAGTATCAGATATATGG + Intronic
987231116 5:15894499-15894521 TCATGCAGGTATAAGAACTATGG + Intronic
987783397 5:22467166-22467188 TCATGCCAGTATGAGGCTTAGGG - Intronic
989951807 5:50308232-50308254 TCATTCTTGTATAAGATGTAAGG + Intergenic
990028083 5:51220772-51220794 TGCTGCCAGTATAGGATTTAAGG - Intergenic
990796224 5:59544100-59544122 TCCTGCCACTACAGGATTTATGG - Intronic
992403446 5:76432710-76432732 TCCTACCTGTATAACATTTATGG + Intronic
993055795 5:82977779-82977801 TCACAACAGTGTAAGATTTAAGG - Intergenic
995322565 5:110853227-110853249 TCTTATCATTATAAGATTTAAGG - Intergenic
1000435098 5:161198326-161198348 TAATGCCAGTTTCAGATTTATGG + Intergenic
1000845756 5:166278491-166278513 TTACGCCTGTTTAAGATTTATGG - Intergenic
1006414795 6:33897062-33897084 CCATGCCAGTAAAATATTTCTGG - Intergenic
1007434059 6:41795852-41795874 TCATGCCAGTCTCAGAAGTATGG + Exonic
1008469950 6:51873578-51873600 TCATGGAAATATAACATTTATGG - Intronic
1012381087 6:98620390-98620412 TCACACCAGAAAAAGATTTAAGG + Intergenic
1013676168 6:112465403-112465425 ACATGGCAGAAGAAGATTTATGG + Intergenic
1016473666 6:144402633-144402655 GAATGACAGTATAAGGTTTATGG - Intronic
1019116381 6:169766757-169766779 TCCTGTAAGTATATGATTTATGG - Intronic
1021145181 7:17078352-17078374 TCATGCTAGTCTAAGATGTCAGG - Intergenic
1024741250 7:52357447-52357469 TCATGCCAGGAAAAGATCTCTGG + Intergenic
1028247060 7:88492271-88492293 TGATGACATTGTAAGATTTATGG - Intergenic
1031747759 7:125524940-125524962 TCATGCCAATCTAAGGATTAAGG - Intergenic
1032588287 7:133168755-133168777 TCACCACAGTGTAAGATTTAAGG + Intergenic
1033217576 7:139504554-139504576 TCACCACAGTGTAAGATTTAAGG - Intergenic
1033376897 7:140770494-140770516 TAATTTCAGTATAATATTTATGG - Intronic
1037167753 8:15851736-15851758 GCATTCCAGTATAAGCTTTCTGG + Intergenic
1037384506 8:18323444-18323466 TCATGGCAGTATATATTTTATGG + Intergenic
1038068259 8:23985592-23985614 TAATGCCAATATAATTTTTAAGG - Intergenic
1040755524 8:50769686-50769708 TCATGCCACCTTAACATTTATGG + Intronic
1044703246 8:94983587-94983609 TAATACCAGTACAAGATTTGGGG - Intronic
1046350974 8:113011727-113011749 TCATGCCAGTATAAGATTTAAGG - Intronic
1050042723 9:1512879-1512901 TCATGCCCAGATAAGAATTATGG - Intergenic
1051695073 9:19759795-19759817 TTATGCCAGTATATGGTTTATGG - Intronic
1052422097 9:28255635-28255657 GCATGTCAGTAAAAGTTTTATGG - Intronic
1058304098 9:103415100-103415122 TCATGCCAAAATAAGAATAATGG - Intergenic
1058938733 9:109793401-109793423 TCAGTGCAGTATAAGATATATGG - Intronic
1059519868 9:114930927-114930949 TCATGGCAGTATGAAATTTGGGG + Intergenic
1059686706 9:116644736-116644758 TCCTCCCAGTATTAAATTTAAGG + Intronic
1060070869 9:120546281-120546303 TCATTTCAATATAAGATTTCAGG + Intronic
1186005502 X:5066467-5066489 TCAGGAGAGCATAAGATTTAAGG - Intergenic
1186899922 X:14043227-14043249 TCTTGTCACTATAGGATTTAAGG - Intergenic
1189189096 X:39081762-39081784 TAATCCCATTATAAGTTTTAAGG - Intergenic
1194433000 X:93834376-93834398 TGATACCAGTTTAAGATTTCTGG + Intergenic
1195777881 X:108427653-108427675 TCATGCCACTCTAACATTTGTGG - Intronic
1199319422 X:146420819-146420841 TCGGCACAGTATAAGATTTAGGG - Intergenic
1200730050 Y:6724958-6724980 TGATGCCAGTCTAACATTTGAGG + Intergenic