ID: 1046355293

View in Genome Browser
Species Human (GRCh38)
Location 8:113076260-113076282
Sequence GACAAGCTATCAACTTCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046355293_1046355294 20 Left 1046355293 8:113076260-113076282 CCTTTTGAAGTTGATAGCTTGTC 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1046355294 8:113076303-113076325 ATCTTTTGCTGCCACTGTCAAGG No data
1046355293_1046355295 21 Left 1046355293 8:113076260-113076282 CCTTTTGAAGTTGATAGCTTGTC 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1046355295 8:113076304-113076326 TCTTTTGCTGCCACTGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046355293 Original CRISPR GACAAGCTATCAACTTCAAA AGG (reversed) Intronic
904790887 1:33020009-33020031 CAGAAGCTTTCAACTGCAAATGG - Intronic
906362203 1:45172308-45172330 GATAAAATATCAACTTCAATTGG + Intronic
907858865 1:58331114-58331136 GTCAAACTATCAACTTTAACAGG + Intronic
911174043 1:94801656-94801678 GGCAATTTATCAAATTCAAAAGG - Intergenic
912735191 1:112144140-112144162 GACAAGGTATTAGCCTCAAACGG + Intergenic
913573536 1:120145214-120145236 TAGTAGCTATCAACTTCACAGGG + Intergenic
914294795 1:146310015-146310037 TAGTAGCTATCAACTTCACAGGG + Intergenic
914555836 1:148760798-148760820 TAGTAGCTATCAACTTCACAGGG + Intergenic
918992787 1:191720182-191720204 GACAATGTAGCACCTTCAAAAGG - Intergenic
919233043 1:194800607-194800629 GGCAAGCAAACATCTTCAAAAGG + Intergenic
920092037 1:203461699-203461721 GTCAAGCTGTATACTTCAAATGG + Intergenic
922354241 1:224760897-224760919 GAAAAGCAATCAACTCCAAGTGG - Intergenic
924171170 1:241342710-241342732 GACAATCTATCAGCTTTAAAAGG - Intronic
1066374839 10:34848630-34848652 GTCAAACTATCAACATGAAAAGG - Intergenic
1072897590 10:99380126-99380148 GACAAGCTCTCGTCTTCTAAGGG + Intronic
1074901148 10:117817349-117817371 GACAAGGTAACAACTTCGCATGG + Intergenic
1076774306 10:132685910-132685932 AACAACCTCTCAACTTCAATTGG - Intronic
1079332518 11:19545467-19545489 GGCAAGCTTTCCACCTCAAAGGG - Intronic
1081437042 11:43038576-43038598 GACAAGCTAAAAATTTTAAATGG + Intergenic
1082954485 11:58855076-58855098 ATCAAGCTATCAACATCAACAGG - Intronic
1082971530 11:59027714-59027736 ATCAAGCTATCAACATCAACAGG - Intronic
1084783508 11:71427711-71427733 GACCAGGCATAAACTTCAAAGGG + Intergenic
1084920133 11:72462528-72462550 GAAATGCTTTCTACTTCAAAAGG + Intergenic
1090637499 11:128699916-128699938 GACATGCAATCACCTTCATATGG - Intronic
1092141876 12:6189594-6189616 GTAAAACTATCAACCTCAAAGGG + Intergenic
1092676000 12:10921291-10921313 CACAAGATATCAAATTCAGATGG - Intronic
1093096490 12:14977815-14977837 GAGAAGTTATCATCTTTAAAAGG - Intronic
1093841598 12:23909233-23909255 GAAAAGCTATTTACTTCAAAAGG - Intronic
1093890962 12:24520393-24520415 AAGATGCTATCAACTTAAAATGG + Intergenic
1095433280 12:42157594-42157616 AACATGCTATCAACTTAGAAAGG + Exonic
1095557670 12:43526510-43526532 AACAAGAAATCAACTCCAAAAGG + Intronic
1100707412 12:97216920-97216942 GACAAGCCCACAACTTAAAATGG - Intergenic
1102384040 12:112492415-112492437 GACAAGAGATTAACTTAAAAGGG - Intronic
1102384043 12:112492456-112492478 CACAAGATATTAACTTAAAAGGG - Intronic
1104328008 12:127818467-127818489 GAAAAGCTATAAATGTCAAAGGG + Intergenic
1106115154 13:26811499-26811521 GACATTCTGTCAACATCAAATGG + Intergenic
1108870584 13:54979549-54979571 GTAAAGCTGTCAAATTCAAAAGG + Intergenic
1110071983 13:71189498-71189520 GAGAAGCTCTCAAATTCCAATGG - Intergenic
1117879122 14:60291710-60291732 TACAAACAATCAACTTCAGAAGG + Intronic
1120227398 14:81806690-81806712 GACAAACTATCACCGTCAAAAGG + Intergenic
1130319750 15:82831144-82831166 CAGAAGCCATCATCTTCAAATGG + Intronic
1133711852 16:8409195-8409217 GAAAACCTACCACCTTCAAATGG - Intergenic
1136231750 16:28889801-28889823 GACAAGAGCTCAACTGCAAAGGG - Intronic
1138518067 16:57549704-57549726 GAAAAGATATTAACTACAAAAGG - Intronic
1139027949 16:62842596-62842618 CACAAGCTACAAAATTCAAAGGG + Intergenic
1141352820 16:83314598-83314620 GACAAGCCCACAACTTCATATGG + Intronic
1141628723 16:85275507-85275529 GACAAGCCACCGAGTTCAAATGG + Intergenic
1153316754 18:3729900-3729922 GACAAACTAGTCACTTCAAAAGG - Intronic
1153834951 18:8955447-8955469 GACAAGATAAAAAGTTCAAAAGG - Intergenic
1156850789 18:41723725-41723747 GACAAGCTGGCACCTTCAAGAGG - Intergenic
1156881605 18:42087070-42087092 GACAATGTACCCACTTCAAAAGG - Exonic
1157416962 18:47511619-47511641 CACAAGCTATCAACATGACAGGG + Intergenic
1157895155 18:51459599-51459621 GACAATCTATGAACTGCAGAAGG + Intergenic
927036114 2:19178295-19178317 CACTAGCTATTAACTTCACATGG - Intergenic
928818989 2:35337628-35337650 GTCAAGGTATCAACATTAAAAGG + Intergenic
929067560 2:37994351-37994373 GACAAGCTAGAAATTTCAGAAGG + Intronic
929626558 2:43414846-43414868 GACAAGCTTTCATCTTAGAAAGG + Intronic
931117842 2:59183888-59183910 GAAAAGCTATCTACAACAAAAGG - Intergenic
932012242 2:67989975-67989997 GAAAAGATATCAGGTTCAAATGG - Intergenic
932934380 2:76084871-76084893 AACAATCTATAAACTTCAGATGG + Intergenic
935724608 2:106012347-106012369 GACATGCTATGAAAGTCAAATGG + Intergenic
936606793 2:113966369-113966391 GAAAAGCTTTCCACTCCAAATGG + Intergenic
936699261 2:114990733-114990755 AACAAGATGTTAACTTCAAAGGG - Intronic
940535896 2:154943932-154943954 CACAGGCTGTCATCTTCAAATGG + Intergenic
940899273 2:159111549-159111571 TACAAGCTATCTACTTCATCTGG - Intronic
942982081 2:182094835-182094857 GCCAAGCTATGATCTTCAATAGG + Intronic
943289366 2:186048950-186048972 CACAAGGGATCAACTCCAAAGGG + Intergenic
943934761 2:193901916-193901938 GTCAAGCTATCAACATAAAAGGG + Intergenic
946713492 2:222529732-222529754 GTCAAGCTATCAACATTAACAGG - Intronic
1173493839 20:43504805-43504827 GACAGGCCATCAACTGCAGAAGG + Intergenic
1173755221 20:45509789-45509811 GAAATACTTTCAACTTCAAATGG + Intergenic
1177616158 21:23523446-23523468 GAAATGCTGCCAACTTCAAAAGG - Intergenic
1178784502 21:35640465-35640487 GACATGCTGTCATCTTCAACCGG - Intronic
1179002775 21:37479069-37479091 GACAAGCCTTCAACATGAAAGGG - Intronic
1182434232 22:30320145-30320167 GACTAGATATCAAAGTCAAATGG + Intronic
1185293284 22:50039593-50039615 GAAAAGATATTACCTTCAAAAGG + Intronic
949338455 3:3003086-3003108 CACAAGCAAGCCACTTCAAATGG + Intronic
950246232 3:11421627-11421649 GTCAAAATATCAACATCAAAAGG - Intronic
951464099 3:22983240-22983262 GATATGCTATAAAGTTCAAATGG - Intergenic
953046004 3:39294665-39294687 GACGAGCTAACCACTTCACAAGG + Intergenic
958894350 3:99813551-99813573 GACAACATAGCATCTTCAAAAGG - Intergenic
959833944 3:110896606-110896628 AACTATCTATCATCTTCAAAAGG + Intergenic
960603913 3:119485460-119485482 GACAAGCTCTGTAGTTCAAAGGG + Intronic
961939701 3:130624448-130624470 GACAAGAAGTCAACTGCAAAAGG + Intronic
965051373 3:163653896-163653918 GTCAAGTTTTCAACATCAAAAGG - Intergenic
967351810 3:188522259-188522281 GAAAATCTATCAATTTCACAAGG + Intronic
980990926 4:139737698-139737720 GACACCTGATCAACTTCAAAGGG - Intronic
983010432 4:162539070-162539092 CATAAGCTAACAAATTCAAAAGG - Intergenic
983355403 4:166650494-166650516 GACCAGGTATCAAATTTAAAAGG - Intergenic
985862098 5:2479065-2479087 GAAAAGAAATCAACTTCAGAAGG + Intergenic
986239034 5:5940484-5940506 CAAATGCTGTCAACTTCAAAAGG - Intergenic
986241988 5:5968947-5968969 GACATTCTATAAACTTCATAGGG - Intergenic
988728990 5:33951403-33951425 GAAAAACTATCACCTTAAAAAGG - Intronic
988854534 5:35215052-35215074 AACAATCTATCAACTTAAGATGG + Intronic
991773713 5:70063640-70063662 TATAGGCTATCAACTTCTAAAGG - Intronic
991853007 5:70939064-70939086 TATAGGCTATCAACTTCTAAAGG - Intronic
992548477 5:77839106-77839128 GTCAAGCTATCTATTTCAGATGG - Intronic
992961793 5:81963032-81963054 GAAAAGAGGTCAACTTCAAAGGG - Intergenic
996951323 5:129129347-129129369 GAAAAGCTAACATCTCCAAAGGG + Intergenic
998365885 5:141630780-141630802 GAGAAGTTATTAACTACAAAAGG + Intronic
998611295 5:143692234-143692256 GAAAGGCTATCAACTTGCAAGGG - Intergenic
1001784491 5:174400470-174400492 CCCAAGCTATAAACTTAAAAAGG + Intergenic
1008946828 6:57107162-57107184 GATATGCTAACAACATCAAAAGG - Intronic
1011655659 6:89549451-89549473 GAGAAGCTATCATCTTGCAAGGG - Intronic
1012383090 6:98643765-98643787 GAGAGGCTGCCAACTTCAAAGGG + Intergenic
1015214799 6:130737327-130737349 GACAAACCATTAAATTCAAAGGG + Intergenic
1015439023 6:133225852-133225874 GGCAAGCAAGCAACTTTAAAAGG + Intergenic
1015627281 6:135192690-135192712 TACACCCTATCTACTTCAAAGGG - Intronic
1018560326 6:165095986-165096008 GAAAAGCTCTCAACTGCAAAAGG - Intergenic
1020781602 7:12523068-12523090 GACAGGATCTCAACTCCAAATGG + Intergenic
1021917397 7:25448681-25448703 GATAAGCTTTAAACTTTAAAAGG - Intergenic
1025555135 7:62298082-62298104 CACATGCAATCAACATCAAATGG + Intergenic
1025681164 7:63682925-63682947 CACAGTCTATCAAGTTCAAAGGG + Intergenic
1025839335 7:65129941-65129963 AAGCAGCTATCAACATCAAAGGG - Intergenic
1025883732 7:65566024-65566046 AAGCAGCTATCAACATCAAAGGG + Intergenic
1025889713 7:65636582-65636604 AAGCAGCTATCAACATCAAAGGG - Intergenic
1027409176 7:77895816-77895838 TACAAGGTATCATCTTTAAAGGG - Intronic
1029447576 7:100622444-100622466 GTCAAGCTGTCACCCTCAAAGGG + Intronic
1031748312 7:125535460-125535482 GAAAAGCTCTCAACAGCAAAAGG + Intergenic
1032821777 7:135530591-135530613 GGTAAGCAAGCAACTTCAAACGG - Intergenic
1034326674 7:150241786-150241808 GACAAGCTATCAATAGAAAATGG + Intergenic
1038470365 8:27812010-27812032 AACAACATATCAACTGCAAACGG + Intronic
1039036001 8:33360053-33360075 AACAAACTATCTACCTCAAATGG + Intergenic
1040921454 8:52624498-52624520 TACAAGCTATCAACATATAATGG - Intronic
1043607266 8:82017278-82017300 GACAAGCTATGAACTAAGAAGGG - Intergenic
1044256912 8:90074321-90074343 GACAATGTATTAACTTCATAAGG - Intronic
1044879629 8:96710663-96710685 AACTAGAAATCAACTTCAAATGG - Intronic
1045754195 8:105522844-105522866 CAAAAGCTTTCAACTTCCAAAGG - Intronic
1046184010 8:110689743-110689765 GAAAAGCTAACTACTTCAGATGG - Intergenic
1046355293 8:113076260-113076282 GACAAGCTATCAACTTCAAAAGG - Intronic
1046671982 8:117066111-117066133 GTCAAACTGTCAACTTCCAATGG + Intronic
1047661073 8:127037543-127037565 CAGAATATATCAACTTCAAAAGG - Intergenic
1050067430 9:1774954-1774976 AACAAACTTTCAACATCAAATGG - Intergenic
1050328988 9:4526170-4526192 GCTAAGCGATCAACTCCAAAAGG + Intronic
1052626594 9:30983158-30983180 GACAAGACGTCAGCTTCAAATGG + Intergenic
1055335515 9:75229516-75229538 GTCATGCTATCAACTCCAATGGG - Intergenic
1056320551 9:85430937-85430959 GACAAGCTATTATATTCTAAAGG - Intergenic
1058707815 9:107651919-107651941 GACATGCCATCAACTTCCATGGG + Intergenic
1059677549 9:116553876-116553898 GACAAGATATCAGCCTCCAAAGG + Intronic
1187706998 X:22018928-22018950 GACAAGCAGTAAACTCCAAATGG + Intergenic
1188827701 X:34856475-34856497 TAAAAGATATCATCTTCAAAAGG - Intergenic
1193625165 X:83810935-83810957 TACACCCTATCAACTTCTAAAGG + Intergenic
1194145127 X:90253226-90253248 AACTAGAAATCAACTTCAAAAGG + Intergenic
1194321547 X:92453512-92453534 GAAATGCTATCAAATTCAAAAGG + Intronic
1194596582 X:95866799-95866821 AACAGGAAATCAACTTCAAAAGG + Intergenic
1194951131 X:100127672-100127694 CACAAGCTATATACTTCAAATGG + Intergenic
1196172821 X:112608786-112608808 GACAAGCTATGAACTTTCACTGG - Intergenic
1196537927 X:116869027-116869049 GACAAGCTGTTAAGTTCAAGAGG + Intergenic
1196561300 X:117152322-117152344 GACATTCTTTCAACTTTAAAAGG + Intergenic
1196603186 X:117624923-117624945 GACAAGCTATAAACTACCATGGG - Intergenic
1198099285 X:133410359-133410381 GACAAGAAAACAAATTCAAAGGG - Intronic
1199346355 X:146745976-146745998 AACAAGGTACCAACTTCACAAGG + Intergenic
1199868077 X:151872301-151872323 ATCATGCTATCATCTTCAAATGG - Intergenic
1200629721 Y:5566989-5567011 GAAATGCTATCAAATTCAAAAGG + Intronic
1200832233 Y:7697964-7697986 AAGAAACTATGAACTTCAAAAGG - Intergenic
1201618006 Y:15923245-15923267 GGCCAGCCATCAGCTTCAAAGGG - Intergenic