ID: 1046355295

View in Genome Browser
Species Human (GRCh38)
Location 8:113076304-113076326
Sequence TCTTTTGCTGCCACTGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046355293_1046355295 21 Left 1046355293 8:113076260-113076282 CCTTTTGAAGTTGATAGCTTGTC 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1046355295 8:113076304-113076326 TCTTTTGCTGCCACTGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046355295 Original CRISPR TCTTTTGCTGCCACTGTCAA GGG Intronic
No off target data available for this crispr