ID: 1046361704

View in Genome Browser
Species Human (GRCh38)
Location 8:113167627-113167649
Sequence CAACACTCCCTGGAAAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046361704_1046361708 23 Left 1046361704 8:113167627-113167649 CCTGTATTTTCCAGGGAGTGTTG 0: 1
1: 0
2: 2
3: 12
4: 117
Right 1046361708 8:113167673-113167695 CACTTGTGAAGTTTTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046361704 Original CRISPR CAACACTCCCTGGAAAATAC AGG (reversed) Intronic
904227520 1:29036164-29036186 CCAGAGTCCCTGGTAAATACAGG - Intronic
905450038 1:38050389-38050411 CAACACCCAGTGGTAAATACAGG + Intergenic
907762626 1:57376530-57376552 GAACAATCCCTGGCAAATATCGG + Intronic
909695474 1:78464066-78464088 CAAAACCTCCTGGAAAATATGGG - Intronic
918087129 1:181255248-181255270 GAACACGACCTGGAAAATAGTGG - Intergenic
921240290 1:213173692-213173714 AAACACTCTCTTAAAAATACGGG - Intronic
921739213 1:218664788-218664810 AAACATTCCCTGGAATATCCTGG + Intergenic
922993656 1:229939008-229939030 CACCACTCCCTGAAAAAGAAAGG + Intergenic
924623644 1:245683491-245683513 CAACACTCCCTGCAAACCCCAGG + Intronic
924875977 1:248105092-248105114 CACCACTCCCTGGCAGATGCTGG + Intergenic
1062993085 10:1838337-1838359 CAACACACTCTGGTAAATACTGG + Intergenic
1064441968 10:15362245-15362267 CAGCACAGCCTGGACAATACTGG - Intronic
1065104548 10:22369172-22369194 CATAACTTCCTGGAAAATATTGG + Intronic
1070554006 10:77514289-77514311 CACCACGCCCTAGAAAATACTGG + Intronic
1076603240 10:131673060-131673082 CAACACACTCTGCAAAACACTGG + Intergenic
1081865773 11:46359503-46359525 CACCAGTCATTGGAAAATACTGG - Intronic
1084518594 11:69649521-69649543 GAACACGCCCTAGAAAATGCAGG - Intronic
1085929011 11:81058266-81058288 GAACAATCCCTGGAACATAGTGG - Intergenic
1086534368 11:87826524-87826546 TAACTCTCCTTGGAAAAGACAGG + Intergenic
1088732392 11:112694726-112694748 CAAAACTACCTGGAAAAAAGGGG - Intergenic
1089345861 11:117791309-117791331 CAAAACTGCCTGAAAAATAGAGG + Intronic
1090253235 11:125265389-125265411 CAAACCTCCCTGGCAAACACCGG + Intronic
1091822465 12:3486382-3486404 CAACTCTTCCTGGAAGATAAGGG + Intronic
1098296366 12:69008173-69008195 CTACACTCCCAGGACAAAACAGG - Intergenic
1098670514 12:73223698-73223720 AAACACTCACTTGAAATTACTGG + Intergenic
1099864548 12:88263061-88263083 CAACACATCCTCAAAAATACTGG + Intergenic
1109531999 13:63662232-63662254 CAAGAATCCCTGGAAAGTACTGG + Intergenic
1110303766 13:73959975-73959997 CTAAACTCCCTGAAAAAAACTGG + Intronic
1116915340 14:50519837-50519859 AAACAATTCCTGGAAAAAACTGG + Intronic
1119002201 14:70892621-70892643 CTTTCCTCCCTGGAAAATACTGG + Intergenic
1119966327 14:78920353-78920375 TAAAACACCCCGGAAAATACTGG + Intronic
1120544759 14:85797344-85797366 GAACAGTCCTTTGAAAATACAGG + Intergenic
1121173349 14:91872460-91872482 CAACAGTCTCTGCAAAATAAAGG + Intronic
1124603745 15:31155172-31155194 CAACACTCTCTGGGAAATGGAGG + Intronic
1124691211 15:31825031-31825053 CAACACTTTCTGAAAGATACTGG - Intronic
1131343702 15:91626960-91626982 CAACACTTCCTGCCAGATACAGG - Intergenic
1131962351 15:97802994-97803016 CAACACTACATGAACAATACCGG + Intergenic
1139397963 16:66655663-66655685 CAGGGCTCCCTGGAAAATCCAGG + Intronic
1146070096 17:29672602-29672624 CAACACTTCCTGGACATTAAAGG - Intronic
1147243282 17:39104851-39104873 CAACAGTGCCTGGAACATAGTGG + Intronic
1148875569 17:50684908-50684930 CAACCCTCCCTGGGAAACCCTGG + Intronic
1156889169 18:42169990-42170012 GCACAGTCTCTGGAAAATACTGG - Intergenic
1157805148 18:50652206-50652228 CAACAATCCCTGGACCATACGGG - Intronic
1159724745 18:71942695-71942717 CAACCCTCACTGGGAAACACAGG + Intergenic
1160157915 18:76447499-76447521 CAACTCTCCCTGTAACACACGGG + Intronic
1162343148 19:10104372-10104394 CAACACTACATGGAACTTACTGG - Intergenic
1164620035 19:29689928-29689950 CAATTATCCCAGGAAAATACGGG - Intergenic
1164834066 19:31345955-31345977 GCACACCCCCTGGAAATTACAGG + Intronic
925531465 2:4867758-4867780 CATGACCCCCTGGACAATACAGG - Intergenic
928885461 2:36143246-36143268 CAAAACTACCTGGAAGATACTGG - Intergenic
929115373 2:38439481-38439503 CAACACTGCATGTAAAATACTGG + Intergenic
935861717 2:107338303-107338325 CAAAGCTCCCTGGAAACTCCGGG - Intergenic
940648907 2:156420933-156420955 AAACATTCCATGAAAAATACAGG - Intergenic
942163921 2:173222555-173222577 CCCCACTTGCTGGAAAATACAGG - Intronic
946474905 2:219997596-219997618 CAGCACTCCATGAAAAACACAGG - Intergenic
947316338 2:228863462-228863484 CAACATTATCTGGAAAAGACAGG - Intronic
1170758371 20:19225428-19225450 CCACAATGCTTGGAAAATACCGG - Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1175018984 20:55824429-55824451 CAACATTACCTGAAAAATCCTGG + Intergenic
1175434890 20:58938204-58938226 CAAAGCTCCCTGGCAAAGACTGG - Intergenic
1180734503 22:18005851-18005873 TAACACTCCCCTGCAAATACAGG + Intronic
1183591019 22:38779349-38779371 CAACTCTCCTTGGAAAAACCAGG + Exonic
1184758431 22:46530968-46530990 CAACACTCCATTGAAAACAGTGG + Intronic
949143723 3:668971-668993 CAACACTTCCTGGTCAATAAAGG + Intergenic
950889327 3:16388925-16388947 TAAGACTCCCTGGAACATTCTGG + Intronic
953350420 3:42211173-42211195 CAACACTCCCCTTGAAATACAGG + Intronic
954938957 3:54353488-54353510 CAAAACTACCTGGAAAATACAGG - Intronic
956963679 3:74433537-74433559 AAACACAACCTGGAAAATGCAGG + Intronic
957614322 3:82508011-82508033 CAATACACCCTGGGAACTACTGG - Intergenic
959519954 3:107314323-107314345 TAACACTCCATTGAAAATGCTGG - Intergenic
959934674 3:112016822-112016844 CAAAGCTCCTTGGAAAACACAGG + Intergenic
960932867 3:122872430-122872452 GAACACTCCCAGGAGAATACAGG - Exonic
965095559 3:164220317-164220339 CAACAATCACGGGAAATTACAGG - Intergenic
966578550 3:181532464-181532486 TATCACTCTTTGGAAAATACTGG - Intergenic
967036162 3:185649642-185649664 CCACACTCCCTGGGACACACAGG + Intronic
969517969 4:7659094-7659116 CAAGACTCCCTGGGAACTCCTGG - Intronic
972608606 4:40636403-40636425 GAACACTGCCTGGAACATAATGG + Intergenic
974616113 4:64284598-64284620 CACCACTCCCTAGAAAATCAAGG + Intronic
979019710 4:115481008-115481030 CAACACTCTCTTTAAAATAAAGG + Intergenic
980133520 4:128838693-128838715 AAACACTTTCTGGAAAATATTGG - Intronic
981303570 4:143220094-143220116 CAACACTCTCTAAAACATACTGG - Intronic
982140720 4:152315268-152315290 CACAACTGCCTTGAAAATACAGG - Intergenic
982846874 4:160264262-160264284 CAACAGTCCCTGGAAAAAACAGG + Intergenic
984512609 4:180697202-180697224 CAACTTTCCTTGGAAAATATTGG + Intergenic
988667679 5:33347844-33347866 CAACAGCCACTGAAAAATACTGG + Intergenic
988872395 5:35405549-35405571 CAACATTCCTGGGAAAATGCAGG - Intergenic
989994017 5:50805459-50805481 CAACACCACCCGGAAAATATAGG + Intronic
991500847 5:67275360-67275382 CTACCCTCCCTGGAAACCACTGG + Intergenic
1001094273 5:168764085-168764107 CAACAGCCCCTGGAAGATAAGGG - Intronic
1002483887 5:179522130-179522152 CAATAATCCCTGGAAATAACAGG + Intergenic
1002500675 5:179645351-179645373 CAATAATCCCTGGAAATAACAGG - Intergenic
1002797935 6:490621-490643 CAACATTACCTAGGAAATACTGG - Intronic
1003466890 6:6389221-6389243 CAAAACTTACTGAAAAATACAGG - Intergenic
1003804925 6:9716797-9716819 TAACATTCCCTAGTAAATACTGG + Intronic
1005163248 6:22890203-22890225 CAAAACACACTGGAAAATTCTGG + Intergenic
1008641198 6:53464656-53464678 CAGCACTCCCTAGTAAATAGCGG - Intergenic
1012310622 6:97719950-97719972 AAACAATGCCTGGAATATACAGG + Intergenic
1012426305 6:99118568-99118590 CAACTCTCCCTGTAAACTACTGG - Intergenic
1016406283 6:143734453-143734475 TAACTCCCCCTGGAAAAGACGGG - Intronic
1017224091 6:152000092-152000114 TCACATTCCCTGGAAAATATGGG - Intronic
1017998532 6:159556956-159556978 CAACACTTTCTAGAAGATACTGG + Intergenic
1018429506 6:163712491-163712513 CAACACTCCCTGGGGAACAGAGG - Intergenic
1019931580 7:4226710-4226732 CAAAACTCCCTGGAAGGCACTGG + Intronic
1023411125 7:39890269-39890291 CACCACTCCCCGAAAAGTACTGG + Intergenic
1026226874 7:68450007-68450029 CAACATTCCCTGACAAATCCTGG + Intergenic
1027699057 7:81446448-81446470 CAACACTCCTTGTAAATTTCAGG - Intergenic
1028103614 7:86851190-86851212 GAACACACCTTGGAAAATGCTGG + Intronic
1028348623 7:89815532-89815554 CAATACTTGCTGGAAAATTCAGG + Intergenic
1028826163 7:95275928-95275950 CAACAATCTCAGGAAAATAAAGG + Intronic
1029797515 7:102910714-102910736 CAACACTCCTAACAAAATACAGG + Intronic
1030286445 7:107831814-107831836 CAACGCTGCCTGGAAAATGATGG - Intergenic
1030596238 7:111542594-111542616 CAACACTCCCAATAAAACACAGG + Intronic
1030623617 7:111818981-111819003 CATCAGGCACTGGAAAATACTGG + Intronic
1033040897 7:137917303-137917325 CAGCACTGCCTGGAAAAGCCGGG + Intronic
1034910729 7:154996278-154996300 CAATAGTCCCTGGACAATACAGG + Intronic
1035586938 8:783759-783781 CAACACTCCCTGCAAGATTCCGG - Intergenic
1040301712 8:46191427-46191449 CAGCACTCCTGGGAAAATCCTGG - Intergenic
1043374399 8:79632156-79632178 CACCACTGCCTGGAAATGACAGG + Intronic
1043507821 8:80920150-80920172 TAACACTCCTTGGAAACTACTGG + Intergenic
1044382313 8:91548826-91548848 CAACACTCCGTTGAAAATAAAGG + Intergenic
1046361704 8:113167627-113167649 CAACACTCCCTGGAAAATACAGG - Intronic
1049342672 8:142121656-142121678 CACCACTCCGTGGACAAGACTGG + Intergenic
1050199201 9:3124934-3124956 CAAATCTCCTTGGAGAATACAGG + Intergenic
1050843371 9:10182425-10182447 CCACATTCTCTGGAAAATAGGGG + Intronic
1052610061 9:30759801-30759823 CAAGACTCTCTGGCAAATATGGG - Intergenic
1054843486 9:69768331-69768353 CAACTGTCCCTGGAGAATAATGG + Intergenic
1058292549 9:103260102-103260124 CACCACTCCCTGGACAAGCCTGG + Intergenic
1058957443 9:109962242-109962264 GGACACTGCCTGGTAAATACTGG + Intronic
1186516508 X:10170189-10170211 TAACACTCCCTGTAGAATAGAGG + Intronic
1187012182 X:15290972-15290994 TAAAACTACTTGGAAAATACAGG + Intronic
1187548274 X:20275013-20275035 CAAAACTCCTTGAGAAATACAGG - Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic