ID: 1046363167

View in Genome Browser
Species Human (GRCh38)
Location 8:113187858-113187880
Sequence TTGGAGAAGTATAAAGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046363167 Original CRISPR TTGGAGAAGTATAAAGGGGT AGG (reversed) Intronic
904890509 1:33776163-33776185 CTAGAGAAGAATGAAGGGGTGGG + Intronic
905085165 1:35367679-35367701 TTAGAGAAAGATAAAGAGGTGGG + Intronic
905569640 1:38993153-38993175 TTTGAAAAGTATAAAGTGATGGG + Intronic
908909474 1:69056393-69056415 TTGAAGAAGTAAAAAGGGGCCGG + Intergenic
910285216 1:85546169-85546191 TTGCAGAAGTATTAAGAAGTGGG + Intronic
914939173 1:152007002-152007024 TCAGAGGAGTATAGAGGGGTTGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916362564 1:163987303-163987325 TTGGACAACTCTAAAAGGGTTGG + Intergenic
916676723 1:167070142-167070164 TTGGAGTAGGATAAAGGTGTTGG + Intronic
917311895 1:173687462-173687484 TCAGAGAAGAAAAAAGGGGTGGG - Intergenic
917452406 1:175157973-175157995 ATGGAGAGGAATAAAGGGCTGGG + Intronic
920397887 1:205659857-205659879 TGGGAGAAGGGTAACGGGGTAGG + Intronic
921531714 1:216291029-216291051 TTGGAGAAGGTTAGAGTGGTTGG - Intronic
922382719 1:225048711-225048733 TTGGACAAATATCTAGGGGTAGG + Intronic
923813912 1:237352852-237352874 TTGGATAGGTATACAAGGGTGGG + Intronic
924400700 1:243677689-243677711 TTGGAGAAAAATAAAAAGGTAGG + Intronic
1065143365 10:22741815-22741837 TTAGAAAACTACAAAGGGGTCGG + Intergenic
1065561445 10:26968100-26968122 TTGGAGACCTATAAAGGAGTTGG - Intergenic
1065757319 10:28943659-28943681 TTTTAAAAGAATAAAGGGGTAGG - Intergenic
1068680135 10:59810474-59810496 ATGGAGCAGTATAAAGGAGGAGG + Intronic
1073073023 10:100806626-100806648 TTGCAGAAGTAGAAAGGAGCCGG + Intronic
1073101414 10:101008616-101008638 CTGGAGCAGCATCAAGGGGTTGG + Intronic
1075138517 10:119809444-119809466 TTGGAGAGAAATAGAGGGGTTGG + Intronic
1075848353 10:125565445-125565467 TTGGAGAAGGATAACGTGGCAGG + Intergenic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1077726781 11:4682816-4682838 TGGGAGAAGACAAAAGGGGTGGG - Intronic
1078808796 11:14736810-14736832 TTAGAAAAGATTAAAGGGGTGGG + Intronic
1078811987 11:14777294-14777316 TTTGAGAAGGAGAAAGGGGGTGG + Intronic
1079310084 11:19357586-19357608 TTGGAGGAGTAAAATGGGGATGG + Intronic
1081673288 11:44953713-44953735 TTAGAAAAGTATATAGGGGCCGG - Intergenic
1085617704 11:78014023-78014045 CTGGACAACTATAAAGGGATTGG + Intergenic
1085743748 11:79097606-79097628 TTGGAGAAAGTTCAAGGGGTAGG - Intronic
1085892152 11:80593263-80593285 TTGGAGAAGCAAAAAGGGACAGG + Intergenic
1087131738 11:94674572-94674594 AAGGAGAAGAATAAAGGGCTGGG + Intergenic
1087166236 11:95006457-95006479 TAGGAGGAGTATAAATGGGATGG - Intergenic
1087236437 11:95723883-95723905 TTGTAGCAGTATTAAGAGGTGGG - Intergenic
1088777233 11:113097184-113097206 TTGAAGAAGTAGAAAGGGCTTGG - Intronic
1088900998 11:114117195-114117217 CTTGAGATGTATAAAGAGGTTGG + Intronic
1090651183 11:128807590-128807612 TTGGTGAAGCATAAAAGGCTTGG - Intronic
1090663388 11:128898094-128898116 TTGGAAAAGAATAAAGTGGAAGG - Intronic
1091338094 11:134788262-134788284 TTTGAGAAGATTAAAGAGGTGGG + Intergenic
1092696296 12:11175446-11175468 ATGCAGAAGCATAAAGGGGTAGG + Intergenic
1092699306 12:11209422-11209444 TGGGAAAAGAATAAAAGGGTAGG + Intergenic
1092756063 12:11764609-11764631 TTGCAGATGTATAAAGGGCATGG + Intronic
1093314938 12:17637676-17637698 TTGGAATAGCATAAAGGGATTGG + Intergenic
1094372679 12:29754866-29754888 GTCAAGAAGTATAAAGAGGTAGG + Intronic
1098769976 12:74539804-74539826 TTTATGAAGTATAAAGGGGTGGG + Exonic
1100361101 12:93880269-93880291 TTGAAGAAAAAAAAAGGGGTTGG - Intronic
1100532371 12:95472540-95472562 TTGGAGAAGTAGATATGGCTGGG + Intergenic
1101965480 12:109279384-109279406 TCGGAGGAGTGTCAAGGGGTCGG + Exonic
1102015774 12:109646963-109646985 AAAGAGAAGGATAAAGGGGTAGG - Intergenic
1102816858 12:115872998-115873020 TTGGGGAGTTATAAAGGTGTTGG + Intergenic
1104139986 12:125978674-125978696 TTGGAGAAGTCTCAGGGGCTGGG + Intergenic
1105607758 13:21941395-21941417 TTGGAGAAGAAAAAAGAAGTAGG - Intergenic
1107364823 13:39658787-39658809 TTGGAGAAACTTAAAGGGGAAGG - Intronic
1108049832 13:46422249-46422271 TTGGACAAGGATAAAATGGTTGG + Intronic
1109542348 13:63795536-63795558 TTGGACAAGGATAAAATGGTTGG + Intergenic
1110634570 13:77751667-77751689 CTGGAGAAGTATAAAGAGCCTGG + Intronic
1111117912 13:83804918-83804940 TTGAGGAAGAATAAAGGGGTGGG + Intergenic
1111421463 13:88017436-88017458 TTTGAGAAGTATATAGGTGTGGG - Intergenic
1112065302 13:95786339-95786361 TTTAAGAAGGGTAAAGGGGTAGG + Intronic
1112729551 13:102345179-102345201 TTGAAGAAGTAAAAAGGATTTGG + Intronic
1117621994 14:57596955-57596977 CTGGAGACGTATTCAGGGGTTGG + Intronic
1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG + Intronic
1122875769 14:104664196-104664218 TTGGGGAAGGTTATAGGGGTTGG + Intergenic
1124213663 15:27786220-27786242 TTGAAGAAGAACAAAGGTGTAGG - Intronic
1124433912 15:29632226-29632248 TTGGAAAAGTAAAAAGAGGCAGG - Intergenic
1127692242 15:61408781-61408803 CTGGAGGAGTATAAAGGAGTTGG - Intergenic
1127892892 15:63270613-63270635 ATGGACAAGTAGATAGGGGTAGG - Intergenic
1128461645 15:67873026-67873048 TTGTAGCAGTATTAAGAGGTGGG - Intergenic
1129650435 15:77483424-77483446 ATGGAGATGTATAAATTGGTGGG - Exonic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1130833444 15:87626522-87626544 TTGGAGAAGTGAAAGGGGCTTGG + Intergenic
1131952656 15:97697522-97697544 TTGTAGCAGTATTAAGAGGTGGG + Intergenic
1131982874 15:98012360-98012382 TTGCAGCAGTATAAAACGGTAGG - Intergenic
1134343127 16:13363601-13363623 TTGGAGAACTGTAAATGGTTTGG + Intergenic
1134853042 16:17497612-17497634 TGGGGAAAGTATAAAGGGATTGG - Intergenic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1135978164 16:27124749-27124771 TTACAGAAGCAGAAAGGGGTGGG + Intergenic
1136364115 16:29800903-29800925 TTGCTGAAGGCTAAAGGGGTTGG - Intronic
1137551584 16:49441045-49441067 GTGCAGAAGTACAATGGGGTTGG + Intergenic
1138440941 16:57034713-57034735 TGGGAGAAGGATGAAGGGGGTGG - Intronic
1139018812 16:62723330-62723352 TTGCAATAGTATTAAGGGGTAGG - Intergenic
1142707620 17:1706467-1706489 TTTGAAAAGTCAAAAGGGGTCGG + Exonic
1142930204 17:3278085-3278107 TCAGACAAGGATAAAGGGGTTGG - Exonic
1143588247 17:7862911-7862933 TTGGAGATTTATAAGGGGGAGGG + Intronic
1144335389 17:14264570-14264592 TTGGAGAAGTATAAAAAGGTAGG - Intergenic
1150592835 17:66578378-66578400 TTGGCGAAGGATAAAGTGGAAGG + Intronic
1153334676 18:3910757-3910779 TTGGACAAAAATAAAGGGTTGGG + Intronic
1154484812 18:14865219-14865241 TGGGAGAAGGATAAAGAGGGTGG - Intergenic
1155757803 18:29523580-29523602 TTGGAGAAGAATGTAGTGGTGGG - Intergenic
1156009524 18:32480427-32480449 TTGGAGAATTTTCAAGGTGTAGG - Intergenic
1156685059 18:39634422-39634444 TTAGAGAAGAATGAAGAGGTAGG - Intergenic
1158646193 18:59249830-59249852 TGGGAGAGGTAGGAAGGGGTGGG + Intergenic
1159402322 18:67954471-67954493 TTGGAGAAGACAAAAGGGGATGG + Intergenic
1162940580 19:14006552-14006574 CTGGTTAAGAATAAAGGGGTAGG + Intronic
1163207782 19:15816007-15816029 TTGGAGAAGAATGAAGGTGACGG - Intergenic
1163311767 19:16519250-16519272 TGGGACCAGTATAAAGGCGTGGG - Exonic
1165893267 19:39127280-39127302 TTGGAGAACAGTAAAGGGGCTGG - Intronic
1167371367 19:49084524-49084546 ATGGAGCAGAATAAAGGGATGGG - Intergenic
1167556871 19:50202302-50202324 CTGGAGCAGTATGAAGGGGAGGG + Intronic
1167818466 19:51904871-51904893 GTGGAGTAGGTTAAAGGGGTAGG - Intronic
1168657670 19:58142826-58142848 AGGGAGAAGGAGAAAGGGGTTGG - Intronic
928204123 2:29271974-29271996 AAGGAGAAGGATAGAGGGGTAGG + Intronic
932682564 2:73838387-73838409 TTGGAGAAGTTTAGATGGGAAGG + Intronic
936964510 2:118114325-118114347 TAGGAGAAGTGTAGAAGGGTTGG + Intergenic
937074527 2:119091268-119091290 TTGGATATGGATGAAGGGGTAGG + Intergenic
939004420 2:136769068-136769090 ATGGAGAAGTTTTAAAGGGTGGG - Intronic
940442438 2:153733941-153733963 TTGAAGAAATAAAAAGGGGATGG - Intergenic
940523263 2:154779201-154779223 TTTGAGAAGTTTAACGGTGTTGG + Intronic
941089829 2:161161167-161161189 TTCTAGAAGTAGAAAGGGGGAGG + Intronic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
942449416 2:176099862-176099884 TTGGAGAAGTAGAAAGAGTCTGG - Exonic
945415304 2:209563550-209563572 CTAGAGAAGTATACGGGGGTGGG - Intronic
945653627 2:212596170-212596192 TGGGAGAAGCATAAAGGAATAGG + Intergenic
945914268 2:215686265-215686287 TTGAAGAAGCACAAAGGGGTGGG - Intergenic
946322862 2:218963577-218963599 TTGGAGGAGCCTAAAGGGGATGG + Intergenic
946827021 2:223689637-223689659 TTGCAGATGTATAGAAGGGTTGG - Intergenic
947479316 2:230483417-230483439 CTGGAGAGGTAGAGAGGGGTTGG + Intronic
949067382 2:242001222-242001244 TTGGAAAACTATAAATAGGTAGG - Intergenic
1169426997 20:5504350-5504372 TTGGAGAAGGACAGAGCGGTGGG - Intergenic
1174913225 20:54629126-54629148 TTGGAGAAAAACAAAAGGGTTGG + Intronic
1175236110 20:57513153-57513175 TTTGAGAACTATTATGGGGTAGG + Intronic
1176688326 21:9874778-9874800 TTAAACAAATATAAAGGGGTGGG + Intergenic
1176796515 21:13374256-13374278 TGGGAGAAGGATAAAGAGGGTGG + Intergenic
1177607213 21:23396355-23396377 TTGGAGAGGTATCTAGGAGTGGG + Intergenic
1177801667 21:25834213-25834235 TGTGAGAGGTAGAAAGGGGTGGG + Intergenic
1178104231 21:29299865-29299887 TTGGAGAATTGTGTAGGGGTAGG + Intronic
1178638618 21:34327656-34327678 ATGGAGATGTACAAAGGGGAGGG - Intergenic
1181170780 22:21008608-21008630 TTGGTAAAGTATAAGGCGGTAGG + Intergenic
1181711861 22:24696182-24696204 GTGGAGGAGGAGAAAGGGGTGGG - Intergenic
1183699180 22:39440478-39440500 TTGAAAAAGTAAAAAGGGGCAGG + Intergenic
1184087508 22:42274052-42274074 TTGGTGAAGGATAAAGGTGAGGG - Intronic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
949936419 3:9119560-9119582 TTGGAGGAGTGTCAAAGGGTTGG - Intronic
950906392 3:16542774-16542796 CTGGAGCAGTAATAAGGGGTGGG - Intergenic
951252015 3:20404762-20404784 TTGGAGAACAATAAAGGGAGAGG + Intergenic
952918523 3:38267708-38267730 TTGCAGAGGAATAAAGGGCTGGG + Intronic
953578402 3:44131362-44131384 TTGTAGAAGTGTAAAGGGGAAGG - Intergenic
954140987 3:48605345-48605367 ATGGAGAAGGATTATGGGGTGGG - Intronic
955869606 3:63423448-63423470 TGGGGCAAGTATTAAGGGGTTGG + Intronic
964248030 3:154676965-154676987 ATGGAGAAGTAGAAAGGAGCTGG - Intergenic
964474959 3:157089871-157089893 TTTGAGAAGTAGAAAGTGCTAGG + Intergenic
964711643 3:159677352-159677374 TTGGACATGTAGTAAGGGGTTGG + Intronic
965350292 3:167603375-167603397 TTAGAGAAGGATAGAGGAGTTGG - Intronic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
967492307 3:190107588-190107610 TTGGAGAACTGTAAAAGGGAAGG + Intronic
967512654 3:190329937-190329959 TTGAAAAAGTATGATGGGGTTGG + Intronic
968177000 3:196559270-196559292 TAGGAGATTTATAAAGGGCTTGG + Intronic
969279237 4:6158483-6158505 TTGGAGTAAAATAAAGGGCTGGG + Intronic
973930080 4:55783223-55783245 TTGAAGAAGTAAAAGGGGATTGG + Intergenic
974475726 4:62377246-62377268 TTAGAGAAGAATAAAGGTATAGG + Intergenic
974689515 4:65278417-65278439 TTGAAAAAGAATAAAGGAGTAGG + Intergenic
975426255 4:74231351-74231373 ATGGAGAAGTTCCAAGGGGTGGG + Intronic
976042410 4:80903317-80903339 TTGGGGAAGGATAAAGGGAAAGG + Intronic
977147050 4:93456562-93456584 TTGGACAAGTTTAAAGAGTTGGG - Intronic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
980351701 4:131692578-131692600 TTAGACAAATATAAAGGGGTGGG + Intergenic
980783926 4:137528217-137528239 TAGGACAAGAAGAAAGGGGTGGG - Intronic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
981146949 4:141334824-141334846 TTGGACCAGTATGAATGGGTGGG + Intergenic
983506338 4:168557590-168557612 TGGAATAAGTTTAAAGGGGTAGG - Intronic
984449608 4:179882480-179882502 TTGAGGAAAAATAAAGGGGTAGG + Intergenic
987702662 5:21421732-21421754 TTAGAGAGTTATAATGGGGTGGG + Intergenic
989156803 5:38352125-38352147 TTGGAGAGGTTTAATGGGCTAGG - Intronic
989252094 5:39329172-39329194 CTGTAGAAGTAAAAAGGGGAGGG - Intronic
989792517 5:45422773-45422795 TTGCAGAAATATAAAAGGGGTGG - Intronic
990249548 5:53898948-53898970 TTGCAGAAATAAAAAGGGGCTGG - Intronic
991639450 5:68738609-68738631 GTGGGGAAGTGGAAAGGGGTGGG - Intergenic
992968871 5:82034659-82034681 CTGGAGCAGAATAAAGGAGTGGG - Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993010182 5:82472333-82472355 TTGGAGAAATTCAAAGTGGTAGG + Intergenic
993784352 5:92110168-92110190 TTTAAGAAGTATAAAGGGTAAGG + Intergenic
994716083 5:103323175-103323197 TTGGAAAAATATTAAGTGGTGGG + Intergenic
994773781 5:104017641-104017663 TTGGGGAAGTATTAAGAGCTGGG - Intergenic
998042597 5:138961898-138961920 TTGGAGAAGCTAAAAGGGGAAGG - Intronic
998468370 5:142363972-142363994 GAGGAAAAGGATAAAGGGGTGGG + Intergenic
999632062 5:153581642-153581664 ATGGAGATGTACAGAGGGGTAGG - Intronic
999977026 5:156922000-156922022 TTGGGGAGGGATAAAGGGGAAGG + Intronic
1002801314 6:523934-523956 TTGGGGTAGTATGAAGGTGTGGG + Intronic
1003488110 6:6597039-6597061 TTGGAGAGGTAGAAATGGGAAGG + Intronic
1004296668 6:14418235-14418257 TTGTAGCAGTATTAAGAGGTGGG + Intergenic
1004326392 6:14677476-14677498 TTTGAGAAGGGTAAAGGGGCTGG - Intergenic
1005429358 6:25738133-25738155 TTGAAAAAGAATAAAGTGGTAGG + Intergenic
1007283705 6:40731846-40731868 TTGGAGTAAAATCAAGGGGTGGG - Intergenic
1009671114 6:66752211-66752233 TTGGAGCAGTATGAAAGGCTGGG - Intergenic
1010392988 6:75358236-75358258 CTGGAGAAGTATTAAGGAATTGG + Intronic
1011493042 6:87912193-87912215 TTGGAAAATTATAAAAGGATGGG + Intergenic
1012649276 6:101733366-101733388 ATAGAAAAGAATAAAGGGGTGGG + Intronic
1013191314 6:107806464-107806486 GTGGAGAAGTAGAAACCGGTTGG - Intronic
1013653756 6:112224224-112224246 TTGGAGGATAATAAAGGGGAGGG - Intronic
1013853713 6:114545818-114545840 TTAGAGAAGAATAAAGGTGGAGG + Intergenic
1014324314 6:119973081-119973103 ATACAGAAGTATAAAGGGCTAGG + Intergenic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1017575570 6:155798633-155798655 TTGGGGAAGGATACAGGGGCAGG + Intergenic
1017977785 6:159373466-159373488 GTTGAGAAGTATAGAGTGGTGGG + Intergenic
1018504477 6:164450053-164450075 GTTGAGAAGTATCAAGAGGTCGG + Intergenic
1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG + Intergenic
1020453148 7:8342713-8342735 TTGGAGAAGTATAAATTGTGGGG + Intergenic
1020473586 7:8567942-8567964 TTCTATAAATATAAAGGGGTTGG - Intronic
1022237842 7:28479034-28479056 TTGGGAAAGTATAAAGAGGTGGG + Intronic
1022656185 7:32321348-32321370 GAGGAGAAGAATCAAGGGGTTGG + Intergenic
1023567678 7:41539731-41539753 TGGGTGAAGGATAAAGGGGAGGG - Intergenic
1024955136 7:54910519-54910541 TAGGAGCAGGAAAAAGGGGTAGG + Intergenic
1024959330 7:54958174-54958196 TAGGAGAGGTATTAAGGGGATGG + Intergenic
1028264168 7:88702871-88702893 TTGTAAAAGTATTAAGAGGTAGG - Intergenic
1029290415 7:99498351-99498373 CTGGAGAAGGATAGAGGGGAAGG + Intronic
1030883543 7:114911838-114911860 TTTGAGAAGTAAAATGGGTTTGG - Intergenic
1033447625 7:141436536-141436558 TTGGTGAAGGGTAGAGGGGTGGG + Intronic
1034487543 7:151375268-151375290 TTGGAGAAATATTAAGAGGTGGG + Intronic
1035506423 8:138656-138678 TGGTAGAAGTGTAAAGTGGTAGG - Intergenic
1037281396 8:17246609-17246631 TTAGGGAAGTAGAAAGGGGGCGG - Exonic
1037711697 8:21360338-21360360 TTGCAGAAATCTAAAGAGGTAGG + Intergenic
1038568519 8:28639571-28639593 GAGGGGAAGTATAAAGAGGTAGG - Intronic
1040819984 8:51545794-51545816 TTGTAGAAATATTAAGAGGTTGG - Intronic
1041807877 8:61873576-61873598 TTGGTGACTTATAAATGGGTTGG + Intergenic
1042267219 8:66921237-66921259 TTGGAGAATTAGAAGGGGGTGGG + Exonic
1043063341 8:75532849-75532871 TTGCAGAAGTCTAAATGTGTAGG + Intronic
1043246766 8:78013111-78013133 TTGCAGCAGTATGATGGGGTTGG - Intergenic
1044116365 8:88340404-88340426 TTGTAGAAATATAATGGAGTGGG + Intergenic
1044835402 8:96290616-96290638 TTAAAGAAGTATAAAGGGATGGG - Intronic
1045797342 8:106061500-106061522 TTGGAGTAGTACAAAGGGTGTGG + Intergenic
1045863450 8:106839002-106839024 GTGAAGAACTATTAAGGGGTGGG + Intergenic
1046019436 8:108646887-108646909 TTGGAGAATAACACAGGGGTGGG + Intronic
1046363167 8:113187858-113187880 TTGGAGAAGTATAAAGGGGTAGG - Intronic
1048130336 8:131689204-131689226 TTGGAAAGGTATTAAGAGGTGGG + Intergenic
1048420753 8:134275969-134275991 CTGGAGAAGTGTAAAGGGTTTGG - Intergenic
1053781016 9:41607123-41607145 TTAAACAAATATAAAGGGGTGGG - Intergenic
1054168959 9:61817280-61817302 TTAAACAAATATAAAGGGGTGGG - Intergenic
1054668573 9:67763531-67763553 TTAAACAAATATAAAGGGGTGGG + Intergenic
1056139502 9:83662064-83662086 TTGGATAAGTTTCAAGAGGTGGG - Intronic
1056886307 9:90447264-90447286 TTTGGGAAGTGTAAAGAGGTTGG + Intergenic
1058060677 9:100492631-100492653 TAGGAGAAGGAAAAAGGAGTGGG + Intronic
1058787821 9:108407584-108407606 TTGGGGCAGTAGAAAGGGGGTGG + Intergenic
1060706980 9:125811914-125811936 TTGTGGTAGTATTAAGGGGTGGG + Intronic
1186829642 X:13377938-13377960 ATAAAGAAGAATAAAGGGGTGGG - Intergenic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1187503518 X:19859752-19859774 TTGGACAAGTATAATAGGTTGGG + Intronic
1187562225 X:20413558-20413580 TCAGAGAAGTACAAAGGTGTGGG + Intergenic
1188045090 X:25416563-25416585 TTTGGGAAGTATAGTGGGGTTGG - Intergenic
1188515603 X:30982209-30982231 TTGGAGAAGGATAAATGGTTTGG - Intergenic
1189018895 X:37313910-37313932 CTTGAGATGTATAAAGAGGTTGG + Intergenic
1189163940 X:38840289-38840311 ATGGACAAGCATAAAGAGGTGGG + Intergenic
1189222780 X:39386579-39386601 TGGGAAAAGTATAAAGAGGTTGG - Intergenic
1189280717 X:39818703-39818725 TTTAAGAAGGATAAAGGGGGGGG + Intergenic
1189751988 X:44231537-44231559 TCTGAGAAGGATAAAGGGGGAGG - Intronic
1190559723 X:51675070-51675092 TTGGAGAAGGAGAACAGGGTGGG - Intergenic
1190564568 X:51718251-51718273 TTGGAGAAGGAGAACAGGGTGGG + Intergenic
1192295566 X:69844081-69844103 TTGAAGAAGAAAAAAGGGGGTGG + Intronic
1192581887 X:72290048-72290070 TTAGAGAAGAATAAAGTGGGAGG - Intronic
1192813187 X:74567257-74567279 TTGCAGAAGAATAAAGTGGGAGG + Intergenic
1193413236 X:81190467-81190489 TTTGGGAAGAATAGAGGGGTTGG - Intronic
1193574170 X:83179058-83179080 TTGGAGAATAATAAGGGGGATGG - Intergenic
1196385814 X:115148665-115148687 TTACAGATGTATAAAGGGTTAGG + Intronic
1197560424 X:128014293-128014315 TTGGAGCAGAATAATAGGGTTGG - Intergenic
1197873283 X:131080171-131080193 TTGAAGCTGTATAAAGGGATTGG - Intronic
1197905304 X:131418614-131418636 TTGAAGAATTATAAAAGGGTTGG - Intergenic
1200048270 X:153414064-153414086 TTGGACAAGTTGAAAGGGGGAGG - Intergenic
1200832025 Y:7695318-7695340 TTGGGGAAGTAGAAAAAGGTTGG + Intergenic