ID: 1046363886

View in Genome Browser
Species Human (GRCh38)
Location 8:113200042-113200064
Sequence ATTCCCATGAGGCATCTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046363886_1046363888 2 Left 1046363886 8:113200042-113200064 CCATTTAGATGCCTCATGGGAAT 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1046363888 8:113200067-113200089 CAAATTTCACGTATCCAAAATGG No data
1046363886_1046363889 3 Left 1046363886 8:113200042-113200064 CCATTTAGATGCCTCATGGGAAT 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1046363889 8:113200068-113200090 AAATTTCACGTATCCAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046363886 Original CRISPR ATTCCCATGAGGCATCTAAA TGG (reversed) Intronic
903199733 1:21725331-21725353 ATTCCCATGAGGTAGGTAGAAGG - Intronic
905716632 1:40157334-40157356 GTTCCTATGAGACATTTAAATGG - Intergenic
907067424 1:51499567-51499589 ATTCCCATGAGCCATGCACAAGG + Intronic
908041437 1:60118234-60118256 ATTTGCCTGAAGCATCTAAATGG + Intergenic
909261906 1:73500844-73500866 ATTCCCATAATGCCTCTGAAGGG - Intergenic
909871811 1:80750037-80750059 TTTTCCATGAGGAATCTGAAAGG - Intergenic
912947894 1:114099862-114099884 ATTTCCATTTGGCATCTAGAAGG + Intronic
920327487 1:205177423-205177445 ATTCTCATGGGGCATTTGAAAGG + Intronic
920874491 1:209821598-209821620 ATTCCCCTTAGACATCTAAGTGG - Intergenic
920879757 1:209868853-209868875 ATTTCCATCAGCCATCTATAAGG + Intergenic
922072704 1:222211786-222211808 ATTCTCATGTGGCTTCTCAAGGG + Intergenic
1062908710 10:1198562-1198584 ATTCCCAATAAGCATGTAAATGG + Intronic
1064606830 10:17050690-17050712 ATTCAAATGAGACACCTAAAAGG + Intronic
1065522338 10:26584907-26584929 GTTCCTATGAGGCTTCTATAAGG + Intergenic
1070741515 10:78906312-78906334 TTTCCCAAGAGGCATCTAGGAGG - Intergenic
1071498546 10:86187769-86187791 ATTTCCATAAGGCAGCTACATGG + Intronic
1071789634 10:88940365-88940387 AATCCCAAGATGCCTCTAAAAGG - Intronic
1072147843 10:92658419-92658441 ATTCCCATGAGCAATGTACAAGG - Intergenic
1074550225 10:114435881-114435903 TTTCCCATGCGGCATCCTAAGGG + Intronic
1077703674 11:4463951-4463973 TTTCCCATGAGACTTGTAAAAGG - Intergenic
1078559884 11:12362269-12362291 ATTACCATGGGGCATCTAGAAGG + Intergenic
1086240469 11:84684231-84684253 ATTCCCCTGTGGCATTTAGAAGG + Intronic
1087817950 11:102679603-102679625 ATTCCCCTGAGGCAATTGAAAGG - Intergenic
1088108295 11:106229795-106229817 CTTTCCATGAGGCTTGTAAAGGG - Intergenic
1089571119 11:119410593-119410615 ATGCCCATTAGACATCCAAATGG - Intergenic
1089658350 11:119968875-119968897 ATACCTATGATGCATCTAAGAGG + Intergenic
1090936151 11:131344409-131344431 GTGCCCCTGAGGCATCTAAGTGG + Intergenic
1096050340 12:48601928-48601950 TTTTCCATGAGGCTTGTAAAGGG - Intergenic
1098001607 12:65949908-65949930 CTTCCCAGGAGACATATAAATGG + Intronic
1102211943 12:111133653-111133675 ATTCCCAGCAGGCCCCTAAAGGG - Intronic
1103287004 12:119810834-119810856 ATTCCCATGAGACTTCGATATGG - Intronic
1103642968 12:122367129-122367151 TTTTCCAAGAGGCATCTAATAGG + Intronic
1107685902 13:42897805-42897827 ATTCCTATCAAGAATCTAAATGG + Intronic
1108095309 13:46894425-46894447 ATTCCGGTGTGGCATTTAAATGG + Intronic
1110104021 13:71647539-71647561 GTTCCCACGGGACATCTAAAAGG + Intronic
1111479145 13:88799291-88799313 ATTCCCATCAACCATCTACAAGG + Intergenic
1118459022 14:65971503-65971525 ATTCCCATGGGGCATTGACAGGG + Intronic
1121111945 14:91318577-91318599 AGTCCCATGAGGGAACTCAAGGG + Intronic
1127250357 15:57229385-57229407 ATTCCCAAGAATCATCTAGAAGG - Intronic
1132895071 16:2224893-2224915 ATTCCCATGATGCTTCTATGAGG - Intronic
1135387749 16:22058751-22058773 ATGCCTATGAGGCATCCAAGTGG + Intronic
1139013960 16:62667374-62667396 ATTCCTATGAGGCTTCAAGAAGG - Intergenic
1140855840 16:78977077-78977099 ATTGCCTGGAGGCATCAAAAAGG - Intronic
1143547413 17:7606004-7606026 AGTCCTATGAGGCATGTAATAGG - Intronic
1144471452 17:15545732-15545754 ATTACCATCAGACATCTTAATGG + Intronic
1144925022 17:18798974-18798996 ATTACCATCAGACATCTTAATGG - Intronic
1152488913 17:80615529-80615551 TTCCCCATGGGGCATCTTAATGG + Intronic
1155678183 18:28456399-28456421 ACTCCTAGGAGGCCTCTAAATGG + Intergenic
1157449688 18:47775994-47776016 ATTCCCATGAAACATCTAAATGG + Intergenic
1159873801 18:73788086-73788108 ATTCCAATGTGGCCTCTTAAGGG + Intergenic
1162660711 19:12166837-12166859 ATCCACATGAGGTATGTAAAGGG + Intronic
1167006740 19:46781148-46781170 ATTCCCGTGAGGAATCTATTGGG - Intronic
927981837 2:27379170-27379192 ATTCCTAGGAGGGAACTAAAGGG - Intronic
929685495 2:44030426-44030448 GTTCCCATGAGGCATTTCAATGG + Intergenic
932612420 2:73209760-73209782 GTGCCCATGAGACATCTAAGTGG - Intronic
934974449 2:98790768-98790790 ATTCCCATTAGACATCTAAGTGG - Intergenic
935958910 2:108404511-108404533 TTTTCCATGAGGCTTGTAAAGGG - Intergenic
942031360 2:171964258-171964280 ATACCCATCATGCATGTAAACGG + Intronic
944153080 2:196582878-196582900 ATTCCCATGTGGCAACAATAAGG + Intronic
944965075 2:204922113-204922135 CTTCCCATGGGATATCTAAATGG + Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
946055955 2:216902010-216902032 CAACCCATGAGGCATCTACAGGG + Intergenic
947929011 2:233947556-233947578 ATCCCCAGGTGGCATATAAATGG - Intronic
1171505428 20:25629327-25629349 ATTCCTATGAGGCTTCTCCATGG + Intergenic
1174827032 20:53777680-53777702 ATTTCCATGAAGGATCTTAAAGG + Intergenic
1175032368 20:55968694-55968716 ATTCCCATGAGCAATGTACAAGG + Intergenic
1177859023 21:26430840-26430862 ATGCCCACTAGGCATCTCAATGG - Intergenic
1178511108 21:33205863-33205885 ATTCCCCTTAGACATCTAACAGG + Intergenic
950677455 3:14563300-14563322 ATACCCTTGAGGCATTTTAAGGG - Intergenic
951633883 3:24751891-24751913 ATTTCCATGAGGCAACTGGAAGG - Intergenic
952071919 3:29647445-29647467 TTTCCCATGAGACATTTACATGG + Intronic
952749508 3:36814049-36814071 ATTCTCATGAGCCTTCTCAAAGG + Intergenic
953198734 3:40757404-40757426 GTTCCCATGAGGATCCTAAAAGG + Intergenic
954947919 3:54442945-54442967 ATTCCCAAGAGGCTACTATATGG - Intronic
957152653 3:76505635-76505657 ATTGGAATGAGGCATCTACAAGG + Intronic
959767965 3:110055948-110055970 ATTCCCATAAATCATGTAAAAGG - Intergenic
960394868 3:117124526-117124548 ATGCCCATTAGGCATCTTTATGG + Intronic
960549686 3:118961017-118961039 AAGCCCATGAGTCATCCAAAGGG - Intronic
962023287 3:131522496-131522518 ATTTCCATGAGGCAGCAGAATGG + Intergenic
963442178 3:145354730-145354752 TTTTCCATGAGGCTTGTAAAGGG + Intergenic
964800911 3:160556326-160556348 ATTCCCATCAGGCATGTATGAGG + Intronic
966907263 3:184536095-184536117 ATTCACATGAGGCCCCTAATGGG + Intronic
967086387 3:186098549-186098571 ATGCTCATGAGACATCAAAAGGG + Intronic
967443362 3:189535201-189535223 ATTTCCATGAGACACGTAAAAGG + Intergenic
967579092 3:191130988-191131010 ATTCCCATCAGCAATGTAAAGGG - Intergenic
971085059 4:23265208-23265230 ATTCCCATGAGGAATGTTTAAGG + Intergenic
971379909 4:26087197-26087219 ATTCCCACGAGGGATCTTAGTGG - Intergenic
971983480 4:33787866-33787888 ATTTCTGTGAGGCAGCTAAATGG + Intergenic
972161637 4:36234966-36234988 AATTCCATGAGGCAACAAAAGGG + Intronic
972730080 4:41785787-41785809 CTTGCCCTGAGGCATCTATATGG - Intergenic
976043393 4:80914828-80914850 ATTCATATCAGGCATCAAAAGGG - Intronic
976045873 4:80946415-80946437 ATTCCCCTGATGCCTTTAAAGGG + Intronic
977475354 4:97500418-97500440 ATGCCCATTAGACATCCAAATGG + Intronic
982645024 4:158012514-158012536 CTTCCCCTGAAGCATCTTAAAGG - Intergenic
983980006 4:173984041-173984063 AATCCTATGAGGCAGCTGAATGG + Intergenic
984994851 4:185420018-185420040 ATTCCCATCAGTAATCTATAAGG + Intronic
987391416 5:17379413-17379435 ATTGCCCTCAGGCTTCTAAATGG + Intergenic
988375817 5:30434445-30434467 CCTGCCATGAGGCATGTAAATGG - Intergenic
990132633 5:52606150-52606172 ATTGCCATGATTCATTTAAAAGG - Intergenic
993878462 5:93336535-93336557 GTTCCCATGGGGCAGCTCAATGG - Intergenic
994287431 5:97986321-97986343 GACCCTATGAGGCATCTAAAGGG + Intergenic
995168309 5:109074684-109074706 ATTTCCATGAAGATTCTAAATGG - Intronic
995220691 5:109644346-109644368 ATGGCCTTGAGGCATCTTAATGG + Intergenic
995717447 5:115093810-115093832 ATTCCCATTAGACATCCAAGTGG + Intergenic
995754068 5:115484087-115484109 ATTCCACTGAGGCAACTGAAAGG + Intergenic
995856175 5:116594625-116594647 ATGTCTATGTGGCATCTAAATGG - Intergenic
998503845 5:142656392-142656414 TTTCCAAGGAGGCATGTAAATGG - Intronic
1001859724 5:175043355-175043377 ATTCACATTAGGCATCTTCAGGG - Intergenic
1002201326 5:177530286-177530308 GTTCCCGTGAGACATCTAAGTGG - Intronic
1003084203 6:3048487-3048509 ATTACCATGAGTCAGGTAAATGG - Intergenic
1003851156 6:10223913-10223935 CTTCCCATGAGGGAGCAAAAGGG + Intergenic
1003882789 6:10493669-10493691 ATTCCAATGAGCCAGTTAAACGG + Intronic
1007012271 6:38429126-38429148 ATGCCCATGAAGTATCTAATGGG - Intronic
1008117178 6:47565520-47565542 ATGCCTATTAGACATCTAAATGG - Intronic
1014028522 6:116675866-116675888 ATGCCCATCAGACATCCAAATGG + Intergenic
1014544716 6:122720596-122720618 ATGCCTACGAGACATCTAAATGG + Intronic
1016019126 6:139217252-139217274 ATTCCCATGATGCAGTCAAAAGG - Intergenic
1018437350 6:163774437-163774459 AATGCCATGAGGCTTCTACATGG + Intergenic
1021781344 7:24109585-24109607 AATCCCATTAGGCATTCAAATGG + Intergenic
1022177245 7:27883336-27883358 ATTCCCATAAGAAATCTCAAAGG - Intronic
1023397072 7:39761221-39761243 TTTTCCATGAGGCTTGTAAAGGG - Intergenic
1023920015 7:44621554-44621576 CTTCCCGTGAGTCATCTTAAGGG + Intronic
1024237548 7:47409476-47409498 CCTCCCATGAGTCATCTTAAAGG + Intronic
1026347865 7:69490546-69490568 CTTCCAAAGAGGCTTCTAAAGGG + Intergenic
1026489348 7:70849364-70849386 TTTCCCCTGAGGCTTGTAAAGGG - Intergenic
1028657059 7:93220571-93220593 ATGCCCATTAGACATCTAAGAGG + Intronic
1030954041 7:115828843-115828865 AAACCCAAGAGGCATCTGAAGGG + Intergenic
1030985102 7:116231917-116231939 AAACCCATGAAGCATCTGAATGG - Intronic
1034702408 7:153108065-153108087 TTTCCCATGAGGAGACTAAATGG - Intergenic
1035845621 8:2861358-2861380 ATTTCAATTAGGCATCCAAAGGG + Intergenic
1036980613 8:13466152-13466174 ATTCCCATGGGGGTTCTAACTGG - Intronic
1039027858 8:33277588-33277610 ATTCCCATTAAGGATCTGAAGGG + Intergenic
1041784922 8:61621087-61621109 CTTCCCATGCTGTATCTAAAAGG + Intronic
1045410538 8:101912928-101912950 CTTCCCATGTGGCATCTCACAGG - Intronic
1046363886 8:113200042-113200064 ATTCCCATGAGGCATCTAAATGG - Intronic
1046808726 8:118508750-118508772 ATTCCCATGAGCAGTCAAAAGGG + Intronic
1048167744 8:132078403-132078425 ATTTTCATGAGGAAGCTAAAAGG - Intronic
1048220518 8:132536974-132536996 CTTCCCATGAGTCATCTGATGGG - Intergenic
1049873711 8:145001675-145001697 TTTGCCAAGAGGCATCTGAAAGG + Intergenic
1050017914 9:1254859-1254881 ATTCCTATGAGGTATGTAAATGG + Intergenic
1050087351 9:1979748-1979770 ATAGCCATGAGGCCTCTAAGTGG + Intergenic
1051679336 9:19591247-19591269 ATGCCTATGAGACATCCAAATGG - Intronic
1052613203 9:30802356-30802378 AGATTCATGAGGCATCTAAACGG - Intergenic
1055424179 9:76176510-76176532 ATTCCAATGAGACTTTTAAAGGG - Intronic
1056223470 9:84472305-84472327 AGTCCCATGGGCCATCCAAATGG - Intergenic
1058784961 9:108377887-108377909 ATTTCCATCTGGCATCTGAAAGG + Intergenic
1197657451 X:129132517-129132539 ATTCCTATTAGACATCCAAATGG + Intergenic
1198455670 X:136815387-136815409 GTTCCCATGAGGCAACAGAATGG - Intergenic
1198585398 X:138115228-138115250 ATTCCTATCTGGCATCTAAGTGG - Intergenic
1199627732 X:149756692-149756714 ACACCCAAGAGGAATCTAAAGGG + Intergenic
1201955618 Y:19619253-19619275 ATACCCCTGAGGAATTTAAATGG + Intergenic