ID: 1046368815

View in Genome Browser
Species Human (GRCh38)
Location 8:113272645-113272667
Sequence TACCCAATACTGGGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046368815_1046368819 3 Left 1046368815 8:113272645-113272667 CCTTTTTTCCCCAGTATTGGGTA 0: 1
1: 1
2: 2
3: 42
4: 203
Right 1046368819 8:113272671-113272693 CTTTATCAGCAGCATTAAAATGG 0: 8
1: 1555
2: 1767
3: 2524
4: 1968

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046368815 Original CRISPR TACCCAATACTGGGGAAAAA AGG (reversed) Intronic
902426468 1:16327042-16327064 TACACTCTAATGGGGAAAAAAGG - Intronic
906345270 1:45010800-45010822 AACTCAATACAGGGGAGAAAAGG + Intronic
906760596 1:48373638-48373660 TACACAAGACTGGGAAGAAAAGG + Intronic
906804612 1:48768478-48768500 AACTTACTACTGGGGAAAAAAGG + Intronic
907481141 1:54746329-54746351 TCCCCCATCCTGTGGAAAAATGG + Intergenic
907767652 1:57425962-57425984 AACTCAATACTGAGGAAAGAGGG + Intronic
909041038 1:70652122-70652144 TACACAATATAGGGGAAAACTGG + Intergenic
909076591 1:71056037-71056059 TAACAAGTAGTGGGGAAAAAGGG - Intergenic
909373316 1:74912955-74912977 TACCCAAGACTGGGAAGAAAAGG + Intergenic
911267773 1:95763219-95763241 TACCCAAGACTGGGAAAAAAAGG + Intergenic
916369130 1:164069654-164069676 TAACAAATACTGGGGATAGAGGG - Intergenic
918231411 1:182536618-182536640 TACCCAAGACAGGGAAGAAAAGG + Intronic
918754384 1:188318870-188318892 CACCAAATAATGGGGAAATATGG - Intergenic
919879126 1:201890591-201890613 CACCCAGTACTGGGCAAGAAGGG + Intronic
920012657 1:202880734-202880756 GTCCCAAAACTGGGGGAAAAGGG + Exonic
920508947 1:206536570-206536592 TCCCCAAAAGTGGGGAGAAAAGG + Intronic
920614196 1:207473185-207473207 AACCCAATAAGGGGGAAAAAAGG + Intronic
920891065 1:209986035-209986057 TACCCAATACTATGGGAGAAAGG - Intronic
924955380 1:248921585-248921607 AAGACAATCCTGGGGAAAAAGGG - Intergenic
1063335776 10:5211773-5211795 TACTCAAGAGTGGGGAAAAAGGG + Intronic
1064678652 10:17787060-17787082 TACCCAAGACTGGGAAGAAAAGG - Intronic
1065604739 10:27405919-27405941 TAGCCTTTAATGGGGAAAAAGGG - Intronic
1065634423 10:27715969-27715991 TTCCCAATCCTGGGAAAAGATGG - Intronic
1067050604 10:43016388-43016410 TACCCAAGACTGAGAAAAAAAGG - Intergenic
1068305952 10:55208555-55208577 TTCCCAATATTGGGAAAAAGAGG + Intronic
1068419818 10:56776701-56776723 TTCATTATACTGGGGAAAAATGG + Intergenic
1069696275 10:70387790-70387812 TACCCAGAGCTGGGAAAAAATGG - Intergenic
1070651741 10:78242342-78242364 TACCAAAGACTGGGAAGAAAAGG - Intergenic
1072007365 10:91266109-91266131 TACCCAATACTGTTGAGGAATGG + Intronic
1072414522 10:95235881-95235903 TGCCAAATACTGGGGGCAAAAGG + Intergenic
1073225235 10:101912957-101912979 TACCAAAGACAGGGAAAAAAAGG + Intronic
1074337150 10:112589529-112589551 GAACTAATACAGGGGAAAAAAGG + Intronic
1074619768 10:115106797-115106819 CACCCAAAACTGGGAAGAAAAGG - Intronic
1076427243 10:130376161-130376183 AACCCAAGACTGGGGAGAAAAGG + Intergenic
1078835995 11:15030467-15030489 TTCACAATTCTAGGGAAAAATGG - Intronic
1079626000 11:22618283-22618305 TACCCAACATGTGGGAAAAAAGG + Intergenic
1080907436 11:36560777-36560799 TTCCCTATAGTGGGGAAAAGGGG - Intronic
1083276233 11:61598589-61598611 TACCTAATCCTGGGGAAATAAGG - Intergenic
1084142915 11:67245596-67245618 TATCTAAACCTGGGGAAAAAAGG - Intronic
1085421879 11:76369786-76369808 TTTCCACCACTGGGGAAAAACGG + Intronic
1085775506 11:79362557-79362579 CATCCAATCCTGGGGAACAACGG + Intronic
1087083893 11:94197506-94197528 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1088154302 11:106784497-106784519 TAAACAAAACTGAGGAAAAAGGG + Intronic
1088766765 11:112989308-112989330 TAGCCAATTATAGGGAAAAAAGG - Intronic
1090115647 11:123969513-123969535 TACACAAAACTGGGGAAAACTGG - Intergenic
1090535285 11:127634470-127634492 TTCCCAAGACTGAGGTAAAAAGG - Intergenic
1092783132 12:12005554-12005576 GATCCAATAGTGGGCAAAAATGG - Intergenic
1094380881 12:29841448-29841470 TAGCCACTACTGAGGAAAAGGGG + Intergenic
1095714610 12:45329261-45329283 TACCACATAATGGGGAAAAAGGG - Intronic
1095808279 12:46344712-46344734 TGCCCAATAGGGGGTAAAAAAGG + Intergenic
1097280102 12:57839951-57839973 TAACCATTACTGGGTAAACAAGG + Intronic
1097357671 12:58620456-58620478 TACCCAAGACTGGAAAGAAAAGG - Intronic
1098715553 12:73825182-73825204 TACCCCAGACTGGAGAAAGAGGG - Intergenic
1100161841 12:91869893-91869915 TGCCTGATACTGGGGAGAAAAGG - Intergenic
1105422347 13:20264273-20264295 TACACAATAGTGAAGAAAAAAGG - Intergenic
1107415359 13:40194794-40194816 AAACCAAAACTGGGGAAAAATGG + Intergenic
1111094652 13:83496823-83496845 TACCCGAGACTGGGAAGAAAAGG - Intergenic
1112676390 13:101707202-101707224 GACCCAAAAATGGGGAAAAAAGG + Intronic
1113151567 13:107269615-107269637 TACAATATAATGGGGAAAAAAGG - Intronic
1113159333 13:107362190-107362212 TACCTGATGGTGGGGAAAAACGG + Intronic
1113280672 13:108783881-108783903 TACCCAAAACTGGGAACAAAAGG - Intronic
1114208712 14:20597848-20597870 CACTTACTACTGGGGAAAAAAGG + Intronic
1115849511 14:37578725-37578747 CAGCCAAGACTGGGGAGAAAGGG + Intergenic
1117903088 14:60555713-60555735 TACCAGAAACTGGGGAGAAAGGG + Intergenic
1120454550 14:84715624-84715646 TACCCGAGACTGGGAAGAAAAGG - Intergenic
1120454816 14:84717545-84717567 TACCCAAGACTTGGAAGAAAAGG - Intergenic
1121299953 14:92862351-92862373 TACCCAAGACTGGGAAGAATAGG + Intergenic
1121792519 14:96709767-96709789 AACCCAAATCTGGGGAAAGAAGG - Intergenic
1124695667 15:31862432-31862454 TACCCGAAACTGGGAACAAAAGG + Intronic
1124795890 15:32779142-32779164 TTCCCCATGCTGGGGAAAATGGG + Intronic
1125042088 15:35200251-35200273 TACAGAATTCTGGGGCAAAATGG + Intergenic
1127095555 15:55508940-55508962 TACCCAAGACTGGGTTATAAAGG + Intergenic
1127332756 15:57954965-57954987 TACCAAATATTGGGGAAAGTGGG - Exonic
1127686421 15:61349940-61349962 GACCCTATAGTGGGGAAGAAAGG - Intergenic
1128134003 15:65249435-65249457 TGCCCAGTGCTGGGGCAAAATGG + Intronic
1128195093 15:65746303-65746325 TACCTAATTCTGGGGGAAAGAGG - Intronic
1130208779 15:81903525-81903547 TCCCCAAATCTGGGGAAGAAAGG - Intergenic
1131729843 15:95268031-95268053 GACCCAAGACTGGGGAATGATGG - Intergenic
1131906997 15:97153575-97153597 TAGGCAATACTGGGGGGAAAGGG - Intergenic
1135476979 16:22785487-22785509 GACCTAACACAGGGGAAAAAGGG - Intergenic
1135692896 16:24558252-24558274 CAGCAAATACTGGGGAAAGATGG + Intronic
1143883881 17:10051855-10051877 TATCCAATGCTGGGGAAAAAGGG - Intronic
1144997201 17:19278320-19278342 TACCCGAGACTGGGAAGAAAAGG + Intronic
1145998338 17:29117158-29117180 TTCCCTAAACTGGAGAAAAAGGG + Intronic
1146149206 17:30452779-30452801 TACCCAAGACTGGAAAGAAAAGG + Intronic
1146742233 17:35296878-35296900 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1149919322 17:60641949-60641971 CACCCTCTACTGAGGAAAAAAGG + Intronic
1152972969 18:183196-183218 TACCAATCACTGAGGAAAAATGG - Intronic
1157633610 18:49127008-49127030 GACACAATACTGAGGAAATACGG - Intronic
1158516663 18:58136406-58136428 AACCCAACACTGGGGAGAGAAGG - Intronic
1159996445 18:74969935-74969957 TACCCGAGACTGGGAAGAAAAGG + Intronic
1167331896 19:48861277-48861299 TATCCATTACTGGAGATAAAAGG - Intronic
1167390068 19:49189066-49189088 TACCCCATCCTGGGCAAAGAAGG - Exonic
929702665 2:44177854-44177876 TATGCAATACTATGGAAAAAAGG - Intronic
929734477 2:44532556-44532578 TAAACCATACTGGGGAAAAATGG + Intronic
930190736 2:48456592-48456614 TACCCATTACATGGGAAATATGG - Intronic
930988181 2:57615129-57615151 TACCCAGTAATGGGGAAATCAGG - Intergenic
931654651 2:64500187-64500209 TACCCATTACTGGGGAAGTAGGG + Intergenic
933357847 2:81236140-81236162 TGCCCAATACTGCAGAAATATGG + Intergenic
940916621 2:159263582-159263604 AACCCAATGCTTGGGGAAAAAGG + Intronic
941803716 2:169688940-169688962 TACCTAAGACTGGGAAAAAGAGG + Intronic
942054447 2:172169061-172169083 TACCCGAGACTGGGAAGAAAAGG - Intergenic
943451214 2:188044590-188044612 TACCCAAGACTAGGAAAAAGAGG + Intergenic
943827831 2:192418020-192418042 TGTCCCCTACTGGGGAAAAAAGG + Intergenic
943871814 2:193009181-193009203 TACCCAACACTGGGAAGAAAAGG + Intergenic
943886587 2:193225621-193225643 CATCCAACACTGGAGAAAAATGG + Intergenic
944363197 2:198883579-198883601 TCTCTAATACTGGGGAAAATAGG - Intergenic
944866912 2:203871297-203871319 TCCCCAACATTGGTGAAAAAAGG - Intronic
945940722 2:215946774-215946796 TACCCTATACTAGGGACAGATGG + Intronic
946507982 2:220321943-220321965 CACCCAATACTAGGGAACAAAGG - Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169157824 20:3348615-3348637 CACCAAATCCTGGGAAAAAAAGG + Exonic
1170402875 20:16006537-16006559 TTCCCAAGTATGGGGAAAAAGGG - Intronic
1170644032 20:18180603-18180625 TACCCAAGACTGGGAAGAAAAGG + Intronic
1170770759 20:19330376-19330398 TCCCCATTAAAGGGGAAAAAGGG + Intronic
1171311261 20:24146596-24146618 TGCCCAATACAAGGGAAAAGAGG + Intergenic
1172871806 20:38140471-38140493 AACCCTATGATGGGGAAAAAAGG + Intronic
1175060375 20:56236639-56236661 CACCCAAGACTGGGAAGAAAAGG - Intergenic
1176931892 21:14823135-14823157 AAACCAATACTGGGGAAATGTGG - Intergenic
1176935492 21:14861727-14861749 TACCCAAGACTGGTAAGAAAAGG + Intergenic
1180218193 21:46340021-46340043 TACCCAAGACTGGGTAATTAAGG + Intronic
1180218984 21:46346114-46346136 TTCACACTCCTGGGGAAAAAAGG - Exonic
1184299430 22:43547415-43547437 AAACCAATAGTGGGGAAAAAAGG + Intronic
950953259 3:17023634-17023656 TACCCGAGACTGGGAATAAAAGG - Intronic
952432194 3:33234619-33234641 TACCCACTAAAGTGGAAAAAAGG + Intergenic
953157913 3:40391841-40391863 TCCCCAAAACTGGGGAGAAGGGG + Intronic
953637165 3:44673246-44673268 TACCCAAGACTGGGAAGAAAAGG + Intergenic
956357210 3:68407129-68407151 TAGTCCATACTGGTGAAAAAAGG + Intronic
956822722 3:72968545-72968567 TACCCTTTGGTGGGGAAAAATGG - Intronic
957470785 3:80654745-80654767 TACCCAAGACTGGGAAGAAAAGG - Intergenic
958687656 3:97420657-97420679 TTCCTAAGAATGGGGAAAAAAGG + Intronic
958878234 3:99639515-99639537 TACTAAATGCGGGGGAAAAAAGG - Intronic
958921004 3:100105473-100105495 TAACTAATTCTGGGGCAAAAGGG + Intronic
959952617 3:112197015-112197037 CAGCAAATTCTGGGGAAAAAGGG - Intronic
960597748 3:119422040-119422062 TACCCAAGACTGGGGAATCTGGG - Intergenic
963394412 3:144714358-144714380 CACCCAAAACTGGGAAGAAAAGG + Intergenic
965456963 3:168913147-168913169 TTCCAAATACTGGAGAAAAAAGG - Intergenic
965489940 3:169323286-169323308 CACCCAATACTGGGGGAAGGAGG - Intronic
966022375 3:175231055-175231077 CACCCAATATTGAGTAAAAAAGG + Intronic
972014341 4:34225259-34225281 TACCCAAGACTGGGAAGAAGAGG - Intergenic
973005552 4:45001611-45001633 TACCCGAGACTGGGAAGAAAAGG + Intergenic
974212793 4:58803355-58803377 TACCTGAGACTGGGGAAAAAAGG + Intergenic
974476952 4:62394744-62394766 TACCAGGTACTGGGGAAAGAAGG - Intergenic
974522455 4:63000754-63000776 TACCCAAGACTGAGGGAGAAGGG + Intergenic
974657014 4:64837959-64837981 TGCCATATACAGGGGAAAAACGG + Intergenic
975524725 4:75336429-75336451 TCCCCATTAATGGGGATAAATGG + Intergenic
976003778 4:80402572-80402594 TACCCAAGACTGGGAAGAAAAGG - Intronic
976177827 4:82373061-82373083 TGCCCAAGACTGTAGAAAAAGGG + Intronic
978009428 4:103661889-103661911 GATCCAACACTGGGCAAAAATGG + Intronic
978721242 4:111912204-111912226 TACCAAATAAGGGGGAAATACGG - Intergenic
979241755 4:118453155-118453177 TACCCTATAGTGGAGAAAGAGGG - Intergenic
981393111 4:144216052-144216074 TACCCAAGGCTGGGAAGAAAAGG + Intergenic
982229880 4:153198517-153198539 TACCCGAGACTGGGAAGAAAAGG - Intronic
982658142 4:158174341-158174363 TAGCCAATACAGTGGATAAATGG + Intergenic
984180080 4:176471738-176471760 TACCAAATACTGGCAAAAAATGG - Intergenic
984355683 4:178654573-178654595 TACCCAAGACTGGGAAGAAAAGG - Intergenic
984839544 4:184055487-184055509 TAAACAAGAATGGGGAAAAATGG + Intergenic
985078294 4:186240603-186240625 CACCCAGTACTGCGGAAAACTGG - Intronic
986069692 5:4269862-4269884 TACCCAAGACTGGGAAGAAAAGG + Intergenic
986565561 5:9110178-9110200 TACCAAATACAGTGGAAAACTGG + Intronic
987984176 5:25124470-25124492 TACCCAAGACTGGGAAGAAAAGG - Intergenic
988427504 5:31080479-31080501 TACCCAAGACTGGGAAGAAAAGG + Intergenic
988574374 5:32405799-32405821 TACTCAAAACAGGGGAAAAGAGG + Intronic
991104765 5:62831912-62831934 TACCCGAGACTGGGAAGAAAAGG + Intergenic
995137647 5:108697300-108697322 AAGTCAATACTGGAGAAAAATGG + Intergenic
996925751 5:128824234-128824256 TACCCAATATTGTCTAAAAAGGG + Intronic
997377554 5:133408243-133408265 TATCCAAAACTTGGGAATAAGGG - Intronic
997542976 5:134679954-134679976 TACCCAATACAATGTAAAAATGG - Intronic
998723151 5:144976553-144976575 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1000150220 5:158492923-158492945 TACCCCATGCTGAGGAATAATGG + Intergenic
1001156320 5:169275530-169275552 CACCCAAGACTGGGAAGAAAAGG + Intronic
1002756031 6:160735-160757 AAGACAATTCTGGGGAAAAAGGG + Intergenic
1003476231 6:6486214-6486236 TACTCAGCACTGGGGAAATAAGG + Intergenic
1007558890 6:42789288-42789310 TTCCCAATCCTGGAAAAAAATGG + Intronic
1007777184 6:44230333-44230355 CACCAAATGCTGGGGAAACAGGG - Exonic
1008756010 6:54796401-54796423 TACCCGAGACTGGGAAGAAAAGG - Intergenic
1009601973 6:65812816-65812838 TACAGAAGACTGGGGAATAAAGG - Intergenic
1009824477 6:68847681-68847703 TACCCGAGACTGGGAAGAAAAGG - Intronic
1011928908 6:92685092-92685114 TACCTAATAACGGGGAAAATAGG - Intergenic
1012896714 6:104957356-104957378 TGCCCAGTATTGGGGTAAAAGGG - Intronic
1016643166 6:146374035-146374057 TCCTCAAAACTGGGGATAAAAGG - Intronic
1016884675 6:148948146-148948168 TACCCCATACTGTGGGAAGAGGG + Intronic
1018721456 6:166576201-166576223 TATCCAAGACTGGGAAGAAAGGG - Intronic
1020618291 7:10487587-10487609 TACATAATACAGAGGAAAAATGG + Intergenic
1023064280 7:36361038-36361060 TTACCCATACTGAGGAAAAAAGG + Intronic
1023096512 7:36666127-36666149 TACCAAATATTTGGGAAAGAAGG - Intronic
1023672527 7:42592919-42592941 TACACAATTCTTGGGTAAAATGG + Intergenic
1023748289 7:43343777-43343799 TACCCAGTAATGGGGTCAAATGG + Intronic
1024832327 7:53475376-53475398 TATCCAATACTGTACAAAAAAGG - Intergenic
1027386994 7:77668660-77668682 TACTCAAATTTGGGGAAAAAAGG + Intergenic
1027687647 7:81296810-81296832 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1031144130 7:117979086-117979108 CATCCAGTACTGGAGAAAAATGG + Intergenic
1032272155 7:130419257-130419279 TATCCAAGAATGGGGAAAAAAGG + Intronic
1034209414 7:149349844-149349866 TATCCAAGACTGGGTAATAAAGG + Intergenic
1034320077 7:150172242-150172264 TACCCAAGACTAGGAAGAAAAGG + Intergenic
1034772671 7:153794980-153795002 TACCCAAGACTAGGAAGAAAAGG - Intergenic
1034839284 7:154380829-154380851 TGCCCAGAACTGGGGAAACAGGG - Intronic
1035183252 7:157106105-157106127 TACTCAAGACTGGGAAGAAAAGG - Intergenic
1037435217 8:18855516-18855538 TTTCAAATACTGAGGAAAAAAGG + Intronic
1040464810 8:47684853-47684875 TACCCAATAATGGGAAGGAATGG + Intronic
1040735525 8:50502661-50502683 TTCTGAATACTAGGGAAAAATGG + Intronic
1041756972 8:61324450-61324472 TACCCAAGACTGGGAAGAAAAGG - Intronic
1041998845 8:64097308-64097330 TACGCATTACTGGGAAGAAAGGG + Intergenic
1042215504 8:66426969-66426991 TATGGAATACTGGGGAAGAAAGG - Intergenic
1042745763 8:72103926-72103948 CTCCCACTACTGGGGAAGAACGG - Intronic
1046175334 8:110568713-110568735 TACCCAAGACTGGGCAGAAAAGG + Intergenic
1046368815 8:113272645-113272667 TACCCAATACTGGGGAAAAAAGG - Intronic
1047034991 8:120927800-120927822 TTCCCAATAGTGTGGAAAAGAGG + Intergenic
1048819970 8:138371641-138371663 GAACAAATACTGGGGAAAATTGG - Intronic
1050156150 9:2667996-2668018 TACCCGAGACTGGGAAGAAAAGG - Intergenic
1050305746 9:4304555-4304577 TACTAAATAATGGGGAGAAAAGG + Intronic
1052065456 9:24013290-24013312 TTGCCAAGAGTGGGGAAAAAGGG - Intergenic
1052497423 9:29245330-29245352 TTCCCAAGACTGGGGAGAGAGGG - Intergenic
1055460699 9:76517710-76517732 TAACCAACACTGAGGAGAAATGG + Intergenic
1055816853 9:80217019-80217041 TACCAAAGATTGGGGAGAAAAGG + Intergenic
1055978050 9:81973499-81973521 TACTCAGAACTTGGGAAAAAAGG + Intergenic
1057505530 9:95630387-95630409 TACACAATACTAAGGTAAAAAGG + Intergenic
1057655968 9:96952631-96952653 TTTAAAATACTGGGGAAAAAAGG + Intronic
1058174974 9:101724835-101724857 TACCCAAGACTGGGAAGAAAAGG - Intronic
1058181889 9:101808797-101808819 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1058949620 9:109891384-109891406 TACTTAATAATGGGGGAAAATGG - Intronic
1059400118 9:114063943-114063965 TGCCCAATTATAGGGAAAAAGGG + Intronic
1185893526 X:3839913-3839935 TACCCAAGACTGGGAAGAAAAGG - Intronic
1185898642 X:3878337-3878359 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1185903758 X:3916766-3916788 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1187249990 X:17588605-17588627 GACCAAAAAATGGGGAAAAAGGG - Intronic
1187499745 X:19829922-19829944 TACCCTATACTGTCTAAAAAGGG - Intronic
1187527701 X:20069031-20069053 TATCCAAGACTGGGAAGAAAAGG - Intronic
1187998680 X:24957325-24957347 TAACCAAAACTGGGGAATACTGG + Intronic
1188126655 X:26376497-26376519 TTCCCAACACTGGAGAAAAATGG - Intergenic
1188211818 X:27434636-27434658 TACCCAATAGTGGGGCACAAGGG + Intergenic
1189535875 X:41934892-41934914 TCACCAATACTGGGGTAACATGG + Intergenic
1189621631 X:42846752-42846774 TCTCCATTAATGGGGAAAAATGG + Intergenic
1189648525 X:43161781-43161803 TACAAAATACTGAGGAAAGAAGG + Intergenic
1192940482 X:75906427-75906449 TACCCAATACTGGAGCACCAAGG - Intergenic
1193164883 X:78267382-78267404 TTCCCAAAACAGGGGAAGAAAGG + Intergenic
1193498542 X:82241914-82241936 TACCCAAAACTGGGGAAAAAAGG - Intergenic
1195011626 X:100737828-100737850 GAACAAACACTGGGGAAAAAAGG + Intergenic
1196166557 X:112541371-112541393 GACATAATCCTGGGGAAAAAAGG + Intergenic
1196208473 X:112967909-112967931 TCCCCAAAACTGGGGAAATGGGG - Intergenic
1196480620 X:116142611-116142633 CACCCAACACTGGGAAGAAAAGG - Intergenic
1198863177 X:141092369-141092391 TACCCGAAACTGGGAAGAAAAGG + Intergenic
1198899513 X:141495018-141495040 TACCCGAAACTGGGAAGAAAAGG - Intergenic
1199047297 X:143190219-143190241 TACCTTATAATGGGAAAAAAAGG - Intergenic
1199672039 X:150155569-150155591 CACCCAGGACTGGGGAAAACTGG + Intergenic
1201469325 Y:14316605-14316627 TACCCATGACTGGGAAGAAAAGG - Intergenic
1201469635 Y:14318934-14318956 TACCCAAGACTGGAAAGAAAAGG - Intergenic
1202389464 Y:24354985-24355007 TACCCTATAGTGGAGAAAGAGGG - Intergenic
1202481320 Y:25315129-25315151 TACCCTATAGTGGAGAAAGAGGG + Intergenic