ID: 1046368875

View in Genome Browser
Species Human (GRCh38)
Location 8:113273509-113273531
Sequence CAGCTTGGCAAAGGGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 312}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046368875_1046368882 12 Left 1046368875 8:113273509-113273531 CCACCCATCCCTTTGCCAAGCTG 0: 1
1: 0
2: 1
3: 32
4: 312
Right 1046368882 8:113273544-113273566 GCCTATTAGATACTTATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046368875 Original CRISPR CAGCTTGGCAAAGGGATGGG TGG (reversed) Intronic
900309451 1:2026388-2026410 CCCCTCGGCAGAGGGATGGGAGG - Intronic
900357878 1:2273438-2273460 CAGCTTGGCATGGGGAGGGCAGG + Intronic
900537891 1:3187818-3187840 CAGCTCTGTAAAGGGCTGGGGGG - Intronic
901361012 1:8700569-8700591 CAGTTTGGCCATGGGCTGGGTGG - Intronic
901411592 1:9088124-9088146 AAGCTTGGCATAGGGAGGGTCGG - Intronic
901752851 1:11422127-11422149 CAGCATGGCAGAGGGGTGGGAGG - Intergenic
901916431 1:12503972-12503994 CAGCTTGGCAGAGGGGAGGGCGG + Intronic
903257499 1:22112714-22112736 CAGCCAGGGAAAGGGGTGGGGGG + Intergenic
904828346 1:33290012-33290034 CAGCTTGGATAAAGGATTGGAGG + Intronic
904933143 1:34106529-34106551 CAGCCTGGCAGAGGGAAGGGTGG - Intronic
905183358 1:36179579-36179601 GAGGATGGCAAAGGGAAGGGAGG - Intronic
905581627 1:39086785-39086807 CAACTGAGCAAAGGGATGGTGGG + Intronic
906076361 1:43055078-43055100 CAGCTAGGCAAAGCCATGGGAGG + Intergenic
906203147 1:43972611-43972633 GATCTTGGCAGGGGGATGGGAGG - Exonic
909054510 1:70806150-70806172 CAGCGCGGCAAATGGAAGGGGGG + Intergenic
910975593 1:92902341-92902363 CAGCTTGGCTTGGGGATGTGTGG + Intronic
914082912 1:144426048-144426070 CAGCTTGCCACAGGCATGGCTGG + Intronic
914177829 1:145294552-145294574 CAGCTTGCCACAGGCATGGCTGG + Intronic
914178374 1:145299318-145299340 CAGCTTGCCACAGGCATGGCTGG + Intronic
914178919 1:145304064-145304086 CAGCTTGCCACAGGCATGGCTGG + Intronic
914179297 1:145307247-145307269 CAGCTTGCCACAGGCATGGCTGG + Intronic
914179672 1:145310428-145310450 CAGCTTGCCACAGGCATGGCTGG + Intronic
914180217 1:145315196-145315218 CAGCTTGCCACAGGCATGGCTGG + Intronic
914180762 1:145319966-145319988 CAGCTTGCCACAGGCATGGCTGG + Intronic
914181305 1:145324716-145324738 CAGCTTGCCACAGGCATGGCTGG + Intronic
914181848 1:145329476-145329498 CAGCTTGCCACAGGCATGGCTGG + Intronic
914182393 1:145334229-145334251 CAGCTTGCCACAGGCATGGCTGG + Intronic
914182938 1:145338985-145339007 CAGCTTGCCACAGGCATGGCTGG + Intronic
914183483 1:145343739-145343761 CAGCTTGCCACAGGCATGGCTGG + Intronic
914184027 1:145348509-145348531 CAGCTTGCCACAGGCATGGCTGG + Intronic
914184571 1:145353273-145353295 CAGCTTGCCACAGGCATGGCTGG + Intronic
914185115 1:145358021-145358043 CAGCTTGCCACAGGCATGGCTGG + Intronic
914185660 1:145362774-145362796 CAGCTTGCCACAGGCATGGCTGG + Intronic
914186206 1:145367534-145367556 CAGCTTGCCACAGGCATGGCTGG + Intronic
914186752 1:145372282-145372304 CAGCTTGCCACAGGCATGGCTGG + Intronic
914187296 1:145377036-145377058 CAGCTTGCCACAGGCATGGCTGG + Intronic
914187839 1:145381788-145381810 CAGCTTGCCACAGGCATGGCTGG + Intronic
914188384 1:145386544-145386566 CAGCTTGCCACAGGCATGGCTGG + Intronic
914188927 1:145391300-145391322 CAGCTTGCCACAGGCATGGCTGG + Intronic
915074752 1:153298902-153298924 GAGCTGGGCATGGGGATGGGTGG + Intronic
915504710 1:156346626-156346648 CAGCTGGGCAAAGGTATGTCTGG + Intronic
916024421 1:160821577-160821599 GAGCTTGGCAAAGTGATGAGAGG - Intronic
916389328 1:164313827-164313849 CACCTTGGAAATGAGATGGGGGG + Intergenic
917999373 1:180477122-180477144 CATCTTGACAAAGGGATGTATGG + Intronic
918188014 1:182144611-182144633 CAGCTCAGCACAGGGAAGGGGGG - Intergenic
918774168 1:188608063-188608085 CAGCTTGGAATGGGGATGTGTGG + Intergenic
919944220 1:202308000-202308022 CAGCTTGGCAAGGAGGTGGCAGG - Intronic
920077359 1:203347265-203347287 GACCTTGGCAAAGGGAGGCGGGG - Intronic
920642339 1:207764502-207764524 CTTTTTGGCTAAGGGATGGGGGG - Intronic
920962460 1:210675729-210675751 CTGCTTGGCAAAGAGATGGGAGG + Exonic
921214406 1:212924843-212924865 CAGCTCTGCAAAGGGAGGGCTGG + Intergenic
921745800 1:218739589-218739611 CAGCTGGGCAAGGGGAGGAGTGG - Intergenic
922079331 1:222279596-222279618 GAGCTAGGAAAAGGGAAGGGGGG + Intergenic
922204782 1:223436835-223436857 CAGCTTGTCAAGAGTATGGGAGG - Intergenic
922652597 1:227354186-227354208 GAGGTAGGCAAAGGGATGCGAGG - Intergenic
922807768 1:228399379-228399401 GAGCTTGGCCAAGGCATGGACGG + Intronic
923086834 1:230708710-230708732 CAGCTCGGCAAATCCATGGGTGG - Intronic
923197796 1:231685035-231685057 CCGCCTGGCAAAGAGATGGATGG + Intronic
923251124 1:232180478-232180500 CAGCTTGCCTGAGGGTTGGGGGG - Intergenic
924165780 1:241280752-241280774 CAGCTTCCCAAAGTGCTGGGAGG + Intronic
1064243348 10:13650160-13650182 CTGCTTGGCATAGGGAGGTGGGG + Intronic
1065932704 10:30493535-30493557 CAGCTGGGCAGGGGGCTGGGGGG + Intergenic
1068940765 10:62678618-62678640 CAGCATGGCAAAGGATTTGGAGG - Intergenic
1070321536 10:75358418-75358440 CAGCTTGAGAAAGGGAAAGGGGG + Intergenic
1070340656 10:75495257-75495279 CAGCTTGGAAAACAGAAGGGAGG - Intronic
1070563424 10:77585016-77585038 CAGCTTGGAGAAGGGTAGGGAGG - Intronic
1070604497 10:77889235-77889257 CTGCTTGGCAGAGGCCTGGGAGG - Intronic
1070785069 10:79158006-79158028 CAGCTTGGCCAGGGGAGCGGCGG + Intronic
1073143330 10:101262964-101262986 GGGCTTGGCAAAGGGATTGGGGG + Intergenic
1073176456 10:101560330-101560352 CCACTGGGGAAAGGGATGGGTGG - Intergenic
1073204926 10:101763758-101763780 CAGCTTGAGAAAATGATGGGGGG + Intergenic
1073480910 10:103785509-103785531 CAGCATGGCCCAGGGAAGGGAGG + Intronic
1074061757 10:109972845-109972867 CAGCTTTGCATTGGGTTGGGAGG - Intergenic
1075702295 10:124477507-124477529 CAGCAGGGCAAAGGGGTGGAGGG - Intronic
1075714103 10:124546019-124546041 CAGCTTGGCAGAGGGAGGGAGGG - Intronic
1075730141 10:124631121-124631143 CAGCAAGGCCAAGGGATGGCTGG - Intronic
1076109684 10:127851144-127851166 CACCTGGGCAAAGTGCTGGGCGG + Intergenic
1078694763 11:13620211-13620233 CAGCTTGGCAGTGGCATGGCAGG + Intergenic
1079002924 11:16772928-16772950 GAGCTTGGCACTGGGTTGGGGGG - Intergenic
1080237369 11:30086742-30086764 GAGATTGGCACAGTGATGGGAGG + Intergenic
1081556736 11:44170866-44170888 CATCTGGGCAAGGGTATGGGTGG - Intronic
1081773526 11:45663806-45663828 CTGCTGGGGAAAGGAATGGGTGG - Intronic
1081785221 11:45741795-45741817 CAGCTTGGCAAGAGGCTGGCTGG - Intergenic
1083140965 11:60721343-60721365 CAGCCTCCCAAAGGGTTGGGAGG - Intergenic
1084043592 11:66556417-66556439 CAAATTGGGAAAGGGATTGGGGG - Intronic
1084303054 11:68263850-68263872 CTGCTTGGCCAAGGGATCTGTGG + Exonic
1085259930 11:75198743-75198765 CATCTTGGCTCAGGGATGGGTGG + Intronic
1085967473 11:81545565-81545587 CAGCCAGGCAAAGGGATGGAAGG - Intergenic
1086069775 11:82787899-82787921 CATTTTGGCAAGGGGATGGTTGG + Intergenic
1088551802 11:111020873-111020895 CAGCTTGTCAACGGGAAGGTAGG - Intergenic
1088833919 11:113561169-113561191 CTGCCTGGCAAAGCTATGGGTGG + Intergenic
1089379321 11:118016207-118016229 GAGCTTTGCAAAGGGGTGGGGGG - Intergenic
1089609331 11:119660752-119660774 CAGCATCGCAGAGGGAGGGGTGG - Intronic
1089759782 11:120714967-120714989 CAGAGTGGCAAATGCATGGGAGG + Intronic
1090261594 11:125324895-125324917 CCACTGGGGAAAGGGATGGGAGG + Intronic
1091730834 12:2878878-2878900 CACTTTGGCCAAGGGACGGGCGG + Intronic
1091751185 12:3022155-3022177 CAGCATGGCTATGGGATGGTTGG + Intronic
1092004853 12:5060724-5060746 CAGCTAGTGCAAGGGATGGGAGG + Intergenic
1093559770 12:20524113-20524135 CAGCTTAAGAAAGGGATAGGAGG + Intronic
1098717476 12:73849237-73849259 TAGCTTAGCAAAGAGAGGGGAGG - Intergenic
1099119334 12:78668428-78668450 AAGCAGGGCAAGGGGATGGGAGG - Intergenic
1103133441 12:118487945-118487967 AAGCTTGACATAGGGATGGTTGG + Intergenic
1103564200 12:121807271-121807293 AAGCTAGGGAAAGGGGTGGGAGG - Intronic
1103924944 12:124418459-124418481 CAGCCTGGGAAAGGGAAGGCGGG + Intronic
1104526650 12:129530456-129530478 CAGCTGGGCAAAGGGAGGCTCGG - Intronic
1104609088 12:130213719-130213741 CTGCTTGGAGAAGGGCTGGGGGG + Intergenic
1104756795 12:131274358-131274380 CAGCTTGGCAGGGGGAGGGGAGG - Intergenic
1104997678 12:132668723-132668745 CACCATGGCAGAGGGCTGGGAGG + Exonic
1105631600 13:22175002-22175024 GAGCCTGGCAAAGGGAGAGGAGG + Intergenic
1107400360 13:40063376-40063398 CAGCTTGGCAACGTGCTGGCAGG + Intergenic
1107842339 13:44471993-44472015 CAGCGTGTCAAAGTGATTGGAGG + Intronic
1109437757 13:62328353-62328375 CAGCCTGGCATTGGGATTGGTGG - Intergenic
1111193880 13:84846331-84846353 GAGCTAGATAAAGGGATGGGGGG - Intergenic
1113811812 13:113147270-113147292 CAGCTTGGCATGGGGAGGGCCGG + Intronic
1114173782 14:20300576-20300598 CTGCTTTCCAAAGGGATAGGGGG + Intronic
1114758612 14:25286419-25286441 CAACTTGGAATAGGGATGTGTGG - Intergenic
1115128107 14:30020470-30020492 CAGCCTGCCAAAGTGAAGGGCGG + Intronic
1117379215 14:55143671-55143693 CAGCTTCCCAAAGTGCTGGGAGG + Intronic
1117450638 14:55846152-55846174 TAGCCTGCCAAAGGGATGTGTGG - Intergenic
1117597116 14:57334538-57334560 CAGCTTGGAATGGGGATGTGTGG - Intergenic
1117665045 14:58047772-58047794 GAGCTTGGGTAAAGGATGGGAGG + Intronic
1117738018 14:58787412-58787434 CAACTTGGCAAATGGGTGGGAGG - Intergenic
1120169481 14:81234483-81234505 CTGCTTGCCAAAGGGCTGGGGGG + Intergenic
1120698207 14:87667996-87668018 CAGCTTGGCAGTGGGGTGGAAGG + Intergenic
1122633988 14:103121863-103121885 CTGCTTGGGAATGGGAGGGGGGG + Intergenic
1202895684 14_GL000194v1_random:7918-7940 CACGTTAGCAGAGGGATGGGTGG - Intergenic
1124252752 15:28117695-28117717 AGGCTTGGAAATGGGATGGGTGG - Intronic
1124632220 15:31344442-31344464 AAGCTTGGCAAATGTCTGGGTGG - Intronic
1125836758 15:42758948-42758970 CAGCTTGGCTCATGGGTGGGTGG - Intronic
1126670432 15:51110808-51110830 AAGCTCAGTAAAGGGATGGGAGG - Intergenic
1126803558 15:52322375-52322397 CCTCCTGGCAAAGGGATGGGAGG + Intronic
1127301323 15:57656607-57656629 TCACTTGGGAAAGGGATGGGAGG + Intronic
1130725190 15:86432008-86432030 CACCTTAGCAGAAGGATGGGAGG - Intronic
1131518382 15:93094878-93094900 CATCTTAGCTAAGGGATGGGAGG + Intergenic
1132113780 15:99121017-99121039 GAGATTTGCAAAGGGATGTGGGG + Intronic
1132376421 15:101331211-101331233 CACCTTGGCAATGGGATGATTGG + Intronic
1132672149 16:1106362-1106384 CAGCTTGGCCCAGGGGTTGGGGG - Intergenic
1132771217 16:1564566-1564588 CAGCATGGCACAGGGACCGGTGG - Intronic
1133065156 16:3200974-3200996 CAGCTGGGGAAGGGGATGTGGGG - Intergenic
1133640176 16:7709169-7709191 CAGCTGGGGAAAGGGAAGGGAGG - Intronic
1134095624 16:11416646-11416668 GAGCTGGGGAGAGGGATGGGAGG + Intronic
1135074909 16:19384780-19384802 CAGATCTGGAAAGGGATGGGTGG + Intergenic
1136530630 16:30866278-30866300 CAGGTTAGCAAAGGGAAGGCTGG + Intronic
1137300307 16:47143225-47143247 CAACTTTGCAAAGGGATGCGCGG + Intronic
1139853051 16:69962145-69962167 CAGCCAGGCAGCGGGATGGGGGG - Intronic
1139882022 16:70185053-70185075 CAGCCAGGCAGCGGGATGGGGGG - Intronic
1140370487 16:74410452-74410474 CAGCCAGGCAGCGGGATGGGGGG + Intronic
1141168547 16:81676803-81676825 CAGCTGGGGGAAGGGGTGGGAGG - Intronic
1141434254 16:83990371-83990393 TTGCTTTGCAAAGGGAAGGGAGG - Intronic
1142612179 17:1115075-1115097 CAGCTGTGCAAAGGGAAGGGGGG + Intronic
1143736683 17:8916220-8916242 GAGCGTGTCAAAGGGGTGGGTGG - Intronic
1145010252 17:19363903-19363925 CAGCTGGGGGAGGGGATGGGTGG + Intronic
1146651484 17:34609559-34609581 CAGCAGGGCAAAGGCAGGGGAGG - Intronic
1147242075 17:39097081-39097103 CTGCTAGGCAAGGGGATGGGAGG - Intronic
1147423618 17:40334779-40334801 CACCTGGGGAAAGGGATGAGGGG - Intronic
1147431250 17:40372069-40372091 CTGCATGGCAAAGGGGTGGTGGG - Intergenic
1147482390 17:40779131-40779153 GAGCCTGGGAAGGGGATGGGGGG - Intronic
1148773326 17:50079330-50079352 CAGCTTGCCAAAGGGGTATGAGG - Intronic
1149422676 17:56526133-56526155 TAGCTGGGCAAAGGATTGGGGGG + Intergenic
1151291995 17:73157023-73157045 CATCTTGCCAAAGGGAAGTGAGG + Intergenic
1151351880 17:73536719-73536741 CAGCATGGCCAGGGGATGTGAGG - Intronic
1151886144 17:76924336-76924358 CAGCTTGGCCAGAGGAGGGGTGG - Intronic
1152342880 17:79734916-79734938 CAGCTAGGAGCAGGGATGGGTGG + Intronic
1152366757 17:79860826-79860848 CAGCAAAGCCAAGGGATGGGAGG - Intergenic
1153887594 18:9480464-9480486 CAGCTTCCCAAAGTGCTGGGAGG - Intronic
1156198553 18:34804157-34804179 CATCTTGACAAATGGATGGGAGG + Intronic
1157397664 18:47356125-47356147 CAGGTTGGGAAAGGGAAAGGAGG - Intergenic
1159899058 18:74025244-74025266 AAGCTTGACAAAGAGATAGGAGG + Intergenic
1160841655 19:1149116-1149138 CAGCTTGGTAGAGGGCGGGGAGG - Intronic
1161197732 19:2996399-2996421 TAGCTTGGAAAAGGGAGGGTGGG - Intergenic
1161284875 19:3463855-3463877 CAGCTGGACAAAGGGGGGGGCGG - Intronic
1161564168 19:4990488-4990510 CAGCGTGGCGAGGAGATGGGAGG + Intronic
1161671352 19:5612823-5612845 CAGCTTGGTCATGGGGTGGGTGG - Intronic
1162249252 19:9428536-9428558 CATCCTGGCTAAGGGATGGAAGG - Intronic
1163031284 19:14545806-14545828 CGGCTTGGGAAAGGGCTGTGTGG + Intronic
1163313243 19:16526295-16526317 CAGCTTGGGCAGGGGAGGGGAGG + Intronic
1164446081 19:28318658-28318680 CAGTGTGGGAAAGGGAAGGGAGG - Intergenic
1164786645 19:30936365-30936387 CAGCTGGGCAAGGAGATGGTGGG - Intergenic
1165778672 19:38419827-38419849 CTGCTTGGGACGGGGATGGGAGG + Intronic
1166794374 19:45417488-45417510 CAGCATGGGCAAAGGATGGGAGG + Intronic
1167007262 19:46784189-46784211 TAGCTTGGCATGGGGTTGGGAGG - Intronic
1167709804 19:51103762-51103784 CAGATTGCCAAAGGGGTGGGAGG - Intronic
1168503173 19:56910535-56910557 CAGCCTGGCCCAGGGCTGGGTGG + Intergenic
927782984 2:25954371-25954393 CAGCTTGGCGTAGAGCTGGGTGG + Exonic
928318001 2:30260593-30260615 CAGCTTGGCAAGGGCTTGGCGGG + Intronic
928922177 2:36537559-36537581 CAGCTTGACAAATGGAAGGATGG - Intronic
929270195 2:39963475-39963497 CAACTTGGAATAGGGATGTGTGG - Intergenic
929555379 2:42922468-42922490 CAGCTTGGCTGAGTGAAGGGTGG - Intergenic
932724368 2:74165797-74165819 TAGCTCGGCAAAGGTAAGGGGGG - Intronic
933379352 2:81523560-81523582 CTGGTTGGCAGAGGAATGGGGGG - Intergenic
933987161 2:87601759-87601781 CAGCTTGGCATAGCCATGGTGGG + Intergenic
936306680 2:111349049-111349071 CAGCTTGGCATAGCCATGGTGGG - Intergenic
938564633 2:132507686-132507708 CAGTTTGTCAGAGGTATGGGCGG - Intronic
939086156 2:137721007-137721029 CAGCTTGGAATGGGGATGTGTGG + Intergenic
939808274 2:146802156-146802178 CAGCTGAGCAAGGAGATGGGAGG + Intergenic
940983021 2:160024274-160024296 CAGCTTGGCATGGGGATGGTGGG - Intronic
941081517 2:161066376-161066398 GAGCTTGGCAAAGTGATAAGTGG + Intergenic
942407935 2:175675557-175675579 CAGCTTGGCAGGGGCAAGGGTGG - Intergenic
942530662 2:176906395-176906417 CAGCTTGACAAAGGGAAGTTCGG - Intergenic
944172909 2:196799338-196799360 GAGCTTAGCACAGGGATGAGGGG + Intronic
945033323 2:205684700-205684722 AATCCTGCCAAAGGGATGGGTGG + Intronic
945161855 2:206899941-206899963 GAGCTTGGCAGGGGGAGGGGTGG - Intergenic
945374265 2:209061063-209061085 CAGCTGAGCAAGGAGATGGGAGG + Intergenic
947525673 2:230875365-230875387 CAGCTTCACAAACGGAAGGGAGG - Intronic
947576935 2:231283044-231283066 CACCAGGGCAAAGGGATGGAGGG + Intronic
948981730 2:241498107-241498129 GAGCTTGGGAAAGGCAGGGGTGG - Intronic
1169730814 20:8783910-8783932 TATCTTGGCCAAGAGATGGGGGG + Intronic
1171877997 20:30596292-30596314 AAGCCAGGCAAAGAGATGGGTGG + Intergenic
1173268689 20:41511566-41511588 CAGATTGGACAAGGGATAGGAGG - Intronic
1173941377 20:46913987-46914009 CAGAGTGGTAAAGGGGTGGGAGG - Intronic
1176360902 21:5995817-5995839 CAGCTTGGCTGGGGGATGTGGGG + Intergenic
1176615377 21:9023981-9024003 CACATTAGCAGAGGGATGGGTGG - Intergenic
1177571086 21:22888098-22888120 GAGCATGTCAAAGGGATAGGGGG + Intergenic
1177978172 21:27877661-27877683 CTGTTTGGCAAAGGGAGAGGGGG - Intergenic
1179762616 21:43542733-43542755 CAGCTTGGCTGGGGGATGTGGGG - Intronic
1179922146 21:44513215-44513237 CAGCCTGGCATAGGGAGGAGGGG - Intronic
1180103936 21:45605115-45605137 CAGCTTGGCTGGGGGATGTGGGG + Intergenic
1183358686 22:37372393-37372415 CAGCTTCGGAAAGGGATGTGGGG + Exonic
1183373701 22:37450002-37450024 CAGCTTCTCCAAGGGGTGGGGGG - Intergenic
1183693014 22:39401729-39401751 GTGCGTGGCAAAGGGATGGCAGG + Intronic
1184457050 22:44616722-44616744 CTGCCCGGCAAAGGAATGGGAGG + Intergenic
1184518885 22:44980562-44980584 AAGATTGGAAAAGGGATGAGTGG + Intronic
1184782077 22:46654542-46654564 AAGGTTGGCAAGGGGCTGGGTGG + Intronic
950053666 3:10009727-10009749 CCACTTGGCAAAGGAAGGGGCGG + Intronic
950305310 3:11912015-11912037 CCACTTGGCAAAGGAAGGGGCGG + Intergenic
950358632 3:12433994-12434016 CAGCTTGGCAAACAGCTGTGAGG - Exonic
950859647 3:16136587-16136609 TAGCTGGTCAAAGGGAAGGGAGG - Intergenic
951400150 3:22222990-22223012 CAGTTTGGAAAAAGGATGGTTGG - Intronic
951876698 3:27434666-27434688 CAGGTTGTGAAAGGGATGTGGGG + Intronic
953676501 3:45006976-45006998 CAGCTTCCCAAAGTGCTGGGAGG + Intronic
953820169 3:46201456-46201478 CAGCATGGCAGGGGGTTGGGGGG - Intronic
954297389 3:49681834-49681856 CAGCTAGGAAGAGGGCTGGGAGG - Intronic
956500580 3:69879340-69879362 CTGCGTGGCAGAGGGAAGGGTGG - Exonic
957790238 3:84931353-84931375 CAGATTGTAAAAGGGATGAGGGG + Intergenic
958128314 3:89385971-89385993 TAGCTTGGCAAAGAGACTGGTGG + Intronic
959638441 3:108602999-108603021 CAGCTTGAAAAAGAAATGGGTGG - Intronic
961440019 3:126947182-126947204 CAGCCTGGCAGAAGCATGGGTGG - Intronic
965548113 3:169935863-169935885 ATGCTTGGTAAAGGGAGGGGAGG - Intronic
965783032 3:172307822-172307844 GAGTTGGGCAAAGGGGTGGGAGG + Intronic
968911455 4:3478759-3478781 CTGCTGGGGACAGGGATGGGTGG - Intronic
968977128 4:3827846-3827868 CATCTGGGCAGAGGGCTGGGTGG - Intergenic
969685471 4:8671685-8671707 CAGCTTGGATGTGGGATGGGAGG + Intergenic
972095167 4:35339977-35339999 AAACTTGGCAAGGGGATGTGTGG + Intergenic
974378933 4:61112824-61112846 CCACATGGCAAAGCGATGGGTGG - Intergenic
975511024 4:75193937-75193959 AAGTCTGGCAAAGTGATGGGGGG - Intergenic
976019509 4:80604111-80604133 GAGCTTGGCCTAGGGAAGGGAGG + Intronic
976243392 4:82983260-82983282 CAGCCTGCCAAAGTGCTGGGTGG + Intronic
976422499 4:84862351-84862373 CACATAGGCAAAGGGCTGGGGGG + Intronic
977195477 4:94053651-94053673 CAGCCTGCCAAAGTGCTGGGAGG + Intergenic
977917801 4:102613330-102613352 CAGCATGGAAGAGGGAAGGGTGG + Intronic
978966491 4:114748237-114748259 CAACTTGGAATAGGGATGTGTGG + Intergenic
979203529 4:118007824-118007846 CTGCTCGGCACAGTGATGGGGGG - Intergenic
981108029 4:140903605-140903627 AAGCCGGGCAAAGGGCTGGGGGG - Intronic
981666951 4:147239423-147239445 CAGCTTGACAAGGTGATGGGAGG - Intergenic
981887468 4:149693982-149694004 CAGATTAGTAAAGGGATGGTGGG - Intergenic
984118772 4:175715537-175715559 CAGCTGGGAGAGGGGATGGGAGG + Intronic
984574325 4:181429440-181429462 CCTCTTGGCAAAGGGAGGGATGG + Intergenic
985837413 5:2281146-2281168 TAGGTGGGCAAATGGATGGGTGG + Intergenic
986239788 5:5950829-5950851 CAGCTTGACAGAGAGATGAGAGG - Intergenic
988864957 5:35324513-35324535 CATGTTGGCAAAGTGATGTGGGG - Intergenic
992641246 5:78770219-78770241 CAGCATGACAAAGGCATGTGAGG - Intergenic
993957632 5:94255439-94255461 CAGCTTGGCATAGCTATGGAAGG + Intronic
994129832 5:96213851-96213873 CCTCTTGGGAAGGGGATGGGAGG - Intergenic
995776551 5:115729673-115729695 CAGCTTGGGGTAGGGGTGGGGGG - Intergenic
997077785 5:130701111-130701133 CAGCTTCCCAAAGTGCTGGGTGG + Intergenic
999423324 5:151464189-151464211 GAGCTGGGCTAAGGGATGTGAGG - Intronic
1001396515 5:171422251-171422273 CATCTTGGGAAAGAGCTGGGTGG + Intronic
1001633311 5:173192543-173192565 CAGATGAGCAGAGGGATGGGAGG - Intergenic
1002832769 6:838403-838425 CAGCTGAACAAAGAGATGGGAGG + Intergenic
1002908180 6:1467877-1467899 CCTCTTGGCCAAGGGTTGGGGGG + Intergenic
1003023211 6:2529967-2529989 CAGCTGGTCAAGGGCATGGGAGG + Intergenic
1004686845 6:17954421-17954443 CAGCTAGTCTAAGGGATGAGGGG - Intronic
1004977797 6:20987506-20987528 CAGCTTCCCAAAGTGCTGGGGGG + Intronic
1005658392 6:27967227-27967249 CAGCTTGGTAAATGGATGCAGGG + Intergenic
1005854654 6:29851764-29851786 CAGGTCTGGAAAGGGATGGGGGG - Intergenic
1006375284 6:33668428-33668450 CAGCTGGGGAAGGGGAAGGGTGG + Intronic
1007637358 6:43307559-43307581 CAGCTTGGGGAAGGGTCGGGAGG + Intronic
1007718796 6:43873031-43873053 CTGCTAGGCAAAGGGATGCTGGG + Intergenic
1007915364 6:45556649-45556671 CAGCTTAGAAAAGGGCTGGATGG - Intronic
1007954610 6:45904873-45904895 CTACTTGGCAGAGGGATGGAGGG - Intronic
1008367927 6:50704417-50704439 AAGACTGGAAAAGGGATGGGTGG + Intergenic
1010954193 6:82071498-82071520 CAGGGTAGTAAAGGGATGGGGGG + Intergenic
1011087904 6:83562883-83562905 CAGCATGCCAAAGGGAAGTGGGG - Intronic
1012017671 6:93872578-93872600 TTGGTAGGCAAAGGGATGGGTGG - Intergenic
1012417467 6:99025669-99025691 CAGCTTGGAAAAGGAATTAGAGG - Intergenic
1012535194 6:100287579-100287601 CAGCTGGGGAAGGGGATGGAAGG + Intergenic
1012633854 6:101510271-101510293 CAGCTATGGAAAGAGATGGGAGG + Intronic
1018991422 6:168676790-168676812 CTGCGTGGCGAAGGGATGGTGGG - Intergenic
1019335225 7:479618-479640 GAGCTTTGGAAAGGGCTGGGTGG + Intergenic
1021595752 7:22314900-22314922 CAGGTTGGCATAGGGATGGCAGG - Intronic
1023053532 7:36273722-36273744 CTGTTAAGCAAAGGGATGGGGGG - Intronic
1023467556 7:40474033-40474055 CAGCTTGACATAGGGAAAGGGGG - Intronic
1026261554 7:68759895-68759917 GAGCCTGCCAAAGGGATGAGTGG - Intergenic
1028070401 7:86443223-86443245 TAGCATGGCAAAAAGATGGGGGG - Intergenic
1029898452 7:104012029-104012051 TAGCTTGGCACAGTGCTGGGAGG - Intergenic
1030379221 7:108793184-108793206 CAGTTTTGCAAATGGATGGCTGG - Intergenic
1032704284 7:134408673-134408695 CTGCCTGGAACAGGGATGGGAGG - Intergenic
1037759614 8:21733267-21733289 GAGCTTGGGAAAGGCAGGGGAGG - Intronic
1037845620 8:22279428-22279450 CAGCCTGGCACTGGGATGGGTGG - Exonic
1040786864 8:51176630-51176652 CAGCTTGGCAAACTGGAGGGAGG + Intergenic
1041138498 8:54788143-54788165 CAGCTTGGCAGATGGCTGGTGGG + Intergenic
1046249554 8:111612063-111612085 CAGCTTGGCAAATGGGTGGTGGG + Intergenic
1046368875 8:113273509-113273531 CAGCTTGGCAAAGGGATGGGTGG - Intronic
1047103924 8:121712313-121712335 CACTTTGGCAAAGTGATGTGAGG - Intergenic
1047445956 8:124919840-124919862 CATCTTGGCAATATGATGGGAGG - Intergenic
1048574350 8:135679281-135679303 CAGCTGGGCTTGGGGATGGGTGG + Intergenic
1048577157 8:135701865-135701887 CAGCTTGGCTTGGGGATGGGTGG + Intergenic
1048732860 8:137462999-137463021 GACATTGGGAAAGGGATGGGTGG + Intergenic
1049364615 8:142231087-142231109 CAGCTGGGTAGAAGGATGGGTGG - Intronic
1049507090 8:143008589-143008611 CAGGCTGGCACAGGGATGTGGGG + Intergenic
1049537147 8:143187761-143187783 CAGCTGGGCGAAGGGTGGGGTGG - Intergenic
1049747615 8:144269675-144269697 CAGCTGGCCAGAGGGAGGGGAGG + Intronic
1050447413 9:5739829-5739851 CAACTTGGAAAGGGGATGTGTGG - Intronic
1053168397 9:35860859-35860881 CAGCTTTGCAAAGGGAGCGGTGG + Intergenic
1053876556 9:42551829-42551851 CAGCTTGTGAATGGCATGGGTGG - Intergenic
1053896119 9:42742874-42742896 CAGCTTGTGAATGGCATGGGTGG + Intergenic
1054235142 9:62549892-62549914 CAGCTTGTGAATGGCATGGGTGG + Intergenic
1054265775 9:62914958-62914980 CAGCTTGTGAATGGCATGGGTGG + Intergenic
1054744795 9:68843612-68843634 CTGCCTGACAGAGGGATGGGTGG - Intronic
1054917546 9:70509576-70509598 CAGCCTCCCAAAGGGCTGGGTGG + Intergenic
1056728943 9:89147398-89147420 CAGTTTGGCAGGAGGATGGGTGG - Intronic
1057266992 9:93623985-93624007 AAGCCAGGCAAAGAGATGGGTGG - Intronic
1057854377 9:98591326-98591348 CAGGATGGAGAAGGGATGGGTGG + Intronic
1059899160 9:118903600-118903622 CACCTTGGCAGGGGGGTGGGGGG - Intergenic
1060218363 9:121751834-121751856 GAGCTTGGCCAGGGCATGGGAGG - Intronic
1060551569 9:124487889-124487911 CAGCATGGGAAAAGGATGGCAGG - Intronic
1060677740 9:125531047-125531069 CAGCTTGTAAAAGGGACAGGTGG + Intronic
1061358018 9:130120959-130120981 CAGTTTGGAAAACAGATGGGAGG + Intronic
1062044217 9:134417694-134417716 CCACTTGGAAAAGGTATGGGAGG + Intronic
1062327220 9:136018053-136018075 CAGCTGTGCAGAGGGAGGGGTGG + Intronic
1186502867 X:10066051-10066073 CAGCATGGCAAAGGCACCGGGGG + Intronic
1188913559 X:35880967-35880989 TAACTTGGCAAAGGGCTTGGTGG - Intergenic
1192213404 X:69141885-69141907 CAGCTGGGCAAAAAGATGAGAGG - Intergenic
1192930508 X:75801045-75801067 CAGGTTGGCACAGGGTTAGGTGG - Intergenic
1193791626 X:85821749-85821771 CAGCTTGTCAGAGAAATGGGGGG - Intergenic
1194012800 X:88583202-88583224 CAGATTGACAGAGGGATGAGAGG + Intergenic
1194105108 X:89759048-89759070 CAGCTTGACATAGGGAAGGAGGG + Intergenic
1195377837 X:104244967-104244989 CAGCTTTGCAAGGGGATTGGGGG + Intergenic
1195643254 X:107200727-107200749 CAGCTTGGAAAGGGGATGGAGGG + Intronic
1199571277 X:149269540-149269562 CAGCTTAGCCAAGGGAAGGATGG + Intergenic
1199672993 X:150162111-150162133 CATGGTGGTAAAGGGATGGGAGG + Intergenic
1200233004 X:154454433-154454455 CAGTGTGGCAAAGGGACTGGGGG + Intergenic
1200249711 X:154546563-154546585 CAGCTTGGCAAGGGGAGGGCTGG - Intronic
1200294096 X:154900485-154900507 CAGCCTTGCAAAGTGCTGGGAGG + Intronic
1200457070 Y:3406866-3406888 CAGCTTGACATAGGGACGGAGGG + Intergenic
1200751154 Y:6945332-6945354 TCGGGTGGCAAAGGGATGGGGGG - Intronic