ID: 1046371249

View in Genome Browser
Species Human (GRCh38)
Location 8:113309797-113309819
Sequence AACAGCATGGAGAAGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 441}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046371249_1046371252 -9 Left 1046371249 8:113309797-113309819 CCCTCAGTCTTCTCCATGCTGTT 0: 1
1: 0
2: 3
3: 36
4: 441
Right 1046371252 8:113309811-113309833 CATGCTGTTTTCCACAACTGAGG 0: 1
1: 0
2: 2
3: 32
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046371249 Original CRISPR AACAGCATGGAGAAGACTGA GGG (reversed) Intronic
901418448 1:9133762-9133784 AACAGCAAGGAAATGACTGAGGG - Intergenic
901648037 1:10727139-10727161 AACAGCCTGGAGAAGGAAGAGGG + Intronic
902782843 1:18715956-18715978 AACAGGATGGAAAAGGCTGATGG - Intronic
903377095 1:22873587-22873609 AACAGCATGGCTTAGACTAAAGG + Intronic
903619657 1:24688785-24688807 GAAAGCATGGAGAAGCCGGAGGG - Intergenic
905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG + Intronic
905433812 1:37943460-37943482 AGCAGCAAGGAGGAGAGTGATGG + Intronic
906479514 1:46190910-46190932 AAGAGGATGGAGAAGACGGTGGG - Intronic
907229756 1:52985306-52985328 AGGAGGATGGGGAAGACTGAGGG - Intronic
908736004 1:67277701-67277723 AACAGGATGGAGGCGACTGACGG - Intergenic
910174782 1:84417613-84417635 AACAGCATGTATAAGCCTGGAGG - Intergenic
910438191 1:87226673-87226695 AACAGCGTGGCGGAGAGTGAGGG + Intergenic
910631584 1:89361017-89361039 AACAACATGGATAAACCTGAAGG - Intergenic
911398675 1:97345619-97345641 AACAGCAGGAAGAAAAGTGATGG + Intronic
912205922 1:107509681-107509703 GGCAGCAAGGAGAAGAATGAGGG - Intergenic
913170116 1:116224379-116224401 AACAGCATGGCCAAGATTGCTGG - Intergenic
913533330 1:119748655-119748677 TGCAGCATGGAGAGGAATGAAGG + Exonic
913610133 1:120502894-120502916 AACAGCCATGAAAAGACTGAGGG - Intergenic
914581057 1:149019345-149019367 AACAGCCATGAAAAGACTGAGGG + Intronic
915285840 1:154851509-154851531 AATTGAATGGAGAAGACTGTGGG - Intronic
916066126 1:161137144-161137166 AACAGCCTGTAGAAGGTTGAAGG + Intergenic
917644339 1:177015335-177015357 AACAGCCTTGAGAAAATTGAAGG + Intronic
917867302 1:179209338-179209360 GACAGCGTGTAGAAGTCTGATGG - Intronic
918259749 1:182785068-182785090 ATTAGCAAGGAGAACACTGAGGG - Intergenic
919427830 1:197455614-197455636 AATAGCATGTAGAAGACTGTAGG + Intronic
920102286 1:203524907-203524929 AACAGCCTGGAGCAAACAGAGGG - Intergenic
920766600 1:208839650-208839672 AACTGCTTGGAGAATACTCAGGG - Intergenic
920883261 1:209899748-209899770 ATTACCATGGGGAAGACTGAAGG - Intergenic
921176388 1:212598754-212598776 AACAACATGGATGAAACTGAAGG - Intronic
922009910 1:221572747-221572769 AACAGCATGCAGTTGAGTGATGG + Intergenic
922850616 1:228730520-228730542 CTCAGAATTGAGAAGACTGAAGG - Intergenic
923428892 1:233901070-233901092 AATAACATGGATAAGCCTGAAGG + Intergenic
923489643 1:234473109-234473131 AAAAGAATGGAGAACACTGGGGG + Intronic
924531823 1:244900074-244900096 AACAGTATTGAGAACACTGAGGG + Intergenic
924749817 1:246875632-246875654 ATCAGCATGGTGACTACTGAAGG - Intronic
1064165271 10:12980342-12980364 AACAGCATGGGGAAGACAGGAGG + Intronic
1064510939 10:16090781-16090803 AACAGGATGGAGATGCCTTAAGG + Intergenic
1064754542 10:18562359-18562381 AATAGCATGAAGAAGAATGGAGG + Intronic
1064937874 10:20699055-20699077 AGCAGCATGAATAAGAATGATGG - Intergenic
1065227991 10:23566479-23566501 AGCAGAATGAAGAAGACAGAGGG - Intergenic
1066139843 10:32493298-32493320 AACAACATGGATGAAACTGAAGG - Intronic
1066435663 10:35395137-35395159 GACCGCAGGGAGAAGACTGAGGG - Intronic
1069019914 10:63474778-63474800 AAAATCAAAGAGAAGACTGAAGG + Intergenic
1069021987 10:63499600-63499622 AACAGTTTAGAGAATACTGAAGG + Intergenic
1069395623 10:67984343-67984365 AACAACATGGACAAAACTGGAGG + Intronic
1070480712 10:76879984-76880006 AACAGCATGGCCAAAACCGAGGG - Intronic
1070689908 10:78516832-78516854 AACAGCAGGGGGAAGGCTGGAGG - Intergenic
1072288863 10:93943718-93943740 AACAGCATGCAGAAGACATTTGG - Intronic
1072295614 10:94006890-94006912 AAGAGCAGGGAGACCACTGAGGG + Intronic
1073522420 10:104145894-104145916 AATAGCATAAAGAAGACAGATGG - Intronic
1074247298 10:111707626-111707648 AAAAGCATGGAGAAGACCCCTGG + Intergenic
1075844330 10:125533466-125533488 AACAGAAGAGAGAAGTCTGAGGG + Intergenic
1077199481 11:1298362-1298384 AGCAGCATGGAGAAGCCAGTCGG + Intronic
1077528127 11:3080950-3080972 AACAACATGGATAAGCCTGGAGG + Intergenic
1078316153 11:10294473-10294495 AACAGAATAGAGAAGGCGGAAGG - Intergenic
1079365293 11:19803730-19803752 AAAAGCAGGGAGAAGAATGAGGG - Intronic
1079834729 11:25320142-25320164 AGCAGCATAGATAAAACTGAAGG - Intergenic
1079929839 11:26544177-26544199 AACAACATGGATAAGACTGGAGG - Intronic
1080067362 11:28033558-28033580 AACAGCATGGATGGAACTGATGG + Intronic
1080722581 11:34864458-34864480 AAAAGCAAGAATAAGACTGACGG - Intronic
1080734918 11:35004270-35004292 AACAACATGGAAAATACTCATGG + Intronic
1080767056 11:35306828-35306850 AGCAACATGGATAAGACTGGCGG - Intronic
1081072397 11:38627961-38627983 AATAGTATGGAGAACACTGATGG + Intergenic
1081123825 11:39298732-39298754 AACAACATGGATAAAACTGAAGG + Intergenic
1081226431 11:40528834-40528856 AACAGCATGGATGAACCTGATGG + Intronic
1083066835 11:59932278-59932300 GACAGCAGGGAGAAGCCAGATGG + Intergenic
1083733386 11:64665843-64665865 AACAAGATGGAGAAGAGTAAAGG + Intronic
1084345411 11:68544011-68544033 GACAGCATGGTGAAGACTCATGG + Intronic
1085370912 11:76004374-76004396 AACCGCATGTAGAAGACAGAAGG - Intronic
1085424803 11:76394483-76394505 AACATCATGGATAGAACTGAAGG - Intronic
1085483120 11:76838930-76838952 GTCAGAAGGGAGAAGACTGAGGG + Intergenic
1086178194 11:83917953-83917975 AAGTGCATGAAGAAGAATGAAGG + Intronic
1086464364 11:87038016-87038038 AACAGCGCGGAGAAGACAGGAGG - Exonic
1087329704 11:96765016-96765038 AGCAGTATGGAGGATACTGATGG - Intergenic
1087716343 11:101613099-101613121 AACAGCATGGAGGAGGCAAAAGG - Intronic
1088169276 11:106977424-106977446 AACAGCATGCAGGACAGTGATGG - Intronic
1088448955 11:109962215-109962237 AACAGTCTGGAGAACACCGATGG + Intergenic
1089799965 11:121019389-121019411 AAGATCATTGTGAAGACTGAGGG + Intergenic
1090916201 11:131165268-131165290 AACAGCATAGAGGAGTCTGGAGG - Intergenic
1091026336 11:132144730-132144752 TACAGCATGGAAATGAGTGAAGG - Intronic
1092128171 12:6089853-6089875 ATCTGCCTGGAGAACACTGAAGG + Intronic
1092146893 12:6220980-6221002 CACAGCCCAGAGAAGACTGAGGG - Intronic
1092601454 12:10070797-10070819 AACGGCATGGACAAGGCAGATGG + Exonic
1092613419 12:10194753-10194775 ATTAGTATGGAGAAGACTGGAGG + Intergenic
1092632717 12:10400439-10400461 AACAACATGGATAAACCTGAAGG + Intronic
1093299478 12:17437377-17437399 AACAACATGGATAAAACTTAAGG + Intergenic
1094446114 12:30532456-30532478 TACAGCAGGGATAAGAGTGAAGG + Intergenic
1094625985 12:32124736-32124758 AACAGCCTGTAGAAGAGGGAAGG + Intronic
1097367183 12:58729826-58729848 AACAGTATGGAGATTTCTGAAGG + Intronic
1097973310 12:65658179-65658201 ACAAAAATGGAGAAGACTGAAGG - Intergenic
1099097867 12:78398144-78398166 AAGTGCATGAAGAAGACTGTGGG - Intergenic
1100224846 12:92545732-92545754 AACAACATGGATGAGCCTGAAGG + Intergenic
1100878353 12:98988397-98988419 AACAGCATGGATAAACCTCAAGG - Intronic
1100953034 12:99873910-99873932 ACCAGCATGCAGGAGACTCAGGG - Intronic
1101300030 12:103470008-103470030 AAGAGCATGGAATATACTGAAGG + Intronic
1101630421 12:106487816-106487838 GAGCTCATGGAGAAGACTGAAGG + Intronic
1102087170 12:110151948-110151970 AACAACATGGATGAGCCTGAAGG - Intronic
1103115342 12:118324691-118324713 AACAACATGGATGAGACTGGAGG - Intronic
1103674581 12:122645409-122645431 AACAGCATGGATGAAACTGGAGG + Intergenic
1105053246 12:133074310-133074332 AACAGCAAGAAGAAGAGTAAAGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1109291914 13:60486896-60486918 AGCAACATGGATAAGCCTGAAGG - Intronic
1109362333 13:61311294-61311316 AACAACATGGAAAAAACTGGAGG - Intergenic
1109681896 13:65762827-65762849 AACAGCAGGGAGTTTACTGAAGG + Intergenic
1110268688 13:73568773-73568795 AATAGAATGGAGGTGACTGAGGG + Intergenic
1110662925 13:78079346-78079368 GACAGCATGGATGAAACTGAAGG - Intergenic
1110663766 13:78091246-78091268 AACAACATGGATGAAACTGAAGG + Intergenic
1111761295 13:92468865-92468887 AACAGCAAGGCAAAGACTGAAGG - Intronic
1112045653 13:95594903-95594925 GACAGTTTGGAGAAGAATGATGG + Intronic
1112095025 13:96123251-96123273 AACGGCATGGATAAAACTCAAGG - Intronic
1112722162 13:102257819-102257841 AAAAGAAAGGAGAAGACTGAAGG - Intronic
1113177241 13:107579039-107579061 GAAAGCATGGAGAAAACTTAGGG - Intronic
1113282315 13:108802383-108802405 AACAACATGGATGAAACTGAAGG - Intronic
1114033001 14:18592170-18592192 AACAGCATGGATAGAACTGGAGG + Intergenic
1114331474 14:21641526-21641548 AACAGGAAGGAAAAGACGGAGGG - Intergenic
1114761175 14:25316197-25316219 AACAACATGGATAAAACTGGAGG - Intergenic
1115128784 14:30027671-30027693 AACAGTATGGAGATTACTCAAGG - Intronic
1115413684 14:33105825-33105847 AATGGCATGGATAAGATTGATGG + Intronic
1116531851 14:45981340-45981362 AATAGTATGGAAAACACTGATGG - Intergenic
1116602108 14:46938960-46938982 AACAACATGGATAAGCCTGGAGG + Intronic
1116659122 14:47685224-47685246 AACAGCATGGATGAAACTGGAGG - Intergenic
1116674946 14:47894057-47894079 AACAACATGGATGAAACTGAAGG + Intergenic
1117092861 14:52267986-52268008 ACCAGCATGTAGAAGACCGAGGG - Exonic
1118056240 14:62082365-62082387 AGCAACATGGAGAAGACTGCAGG - Intronic
1118564573 14:67125333-67125355 AATAGGATGAAGAAGAATGAAGG - Intronic
1119645127 14:76342341-76342363 AACAGCATGGGCAAAAGTGAGGG + Intronic
1119703102 14:76768425-76768447 GACAGGAAGGAGAAGACCGACGG + Intronic
1120445913 14:84595679-84595701 AACAACATGGATAAACCTGAAGG - Intergenic
1120698552 14:87672146-87672168 AACAACATGGATGAAACTGAAGG + Intergenic
1121263081 14:92580749-92580771 AAGAGCATGGAGAAGGCTTGTGG + Intronic
1121619502 14:95336520-95336542 ACCAGCAGGGAGAAGAGTCATGG - Intergenic
1121888695 14:97568974-97568996 TACAGCAAGGAAAAGACTTAAGG + Intergenic
1122050039 14:99051352-99051374 AACAACATGGATAAAACTGAAGG + Intergenic
1123089988 14:105738227-105738249 GACAGCATGGAGGAGAGTGTTGG + Intergenic
1123090317 14:105739404-105739426 GACAGCATGGAGGAGAGTGTTGG + Intergenic
1123906479 15:24926500-24926522 AACAGCATGGTGAAGAAGCAGGG - Intronic
1124042155 15:26115647-26115669 CACAGCATGGAGAAAAGTGCTGG - Intergenic
1124091352 15:26605620-26605642 AACAACATGGATAAAACTGGAGG + Intronic
1124418538 15:29494798-29494820 AACAACATGGATAAGCCTGGAGG - Intronic
1126656071 15:50979423-50979445 TACATCATGAAGAAGACAGAAGG - Intronic
1126829163 15:52582156-52582178 AACATCTTGGTGAAAACTGAGGG + Exonic
1126878862 15:53072960-53072982 AACAGCATGGAGAAAATGTAAGG + Intergenic
1127290164 15:57562866-57562888 ACCAGCATGGACTAGACAGAGGG - Intergenic
1127322738 15:57863457-57863479 AACAGCATGCACAGAACTGAAGG - Intergenic
1128900194 15:71413595-71413617 AATAGCATGGATAGAACTGAAGG - Intronic
1128921054 15:71610535-71610557 AACAGCATGGAGATGACAACAGG + Intronic
1129953951 15:79616083-79616105 AATATGATGGGGAAGACTGAGGG + Intergenic
1130036834 15:80368634-80368656 AACACCATGGAAAAGTCTGGGGG - Intronic
1130909752 15:88262907-88262929 AACGGCATTGAGAACACAGAGGG + Intergenic
1131357769 15:91760691-91760713 AACAGCTCAGAGAGGACTGATGG - Intergenic
1131877022 15:96818960-96818982 AGCAACATGGTGAAGAATGACGG - Intergenic
1131954132 15:97713411-97713433 AACAATATAGAGAAGACTCATGG - Intergenic
1133904256 16:10006926-10006948 AACAACATGGATGAAACTGAAGG - Intronic
1133987835 16:10681996-10682018 CACGGCATGGAGAAAATTGACGG - Exonic
1135493167 16:22927668-22927690 AAAAGCAAAGAGAAAACTGATGG + Intergenic
1136547851 16:30965594-30965616 AAGAGCATGGAGAAGCCTGCGGG - Exonic
1137793680 16:51196638-51196660 ACCAGCATGGAGCAAACAGAAGG - Intergenic
1138299006 16:55910870-55910892 CACAGCATGTGGAAGACTGGAGG + Intronic
1140109266 16:71989127-71989149 AACAGCGTGGGAAATACTGAGGG + Intronic
1140714360 16:77708529-77708551 ATCACCAGTGAGAAGACTGAGGG + Intergenic
1142756436 17:2019102-2019124 CAAGGCCTGGAGAAGACTGAGGG - Intronic
1143175961 17:4955276-4955298 AACATCCTGGAGAACAATGAGGG + Exonic
1143773499 17:9182948-9182970 AGCAGCGTGGAGGAGCCTGAAGG + Exonic
1144124977 17:12194864-12194886 GACAGCATGGAGAAGGTGGATGG - Intergenic
1144544884 17:16184909-16184931 CACAACATGGATAAGCCTGAAGG + Intronic
1144621124 17:16819125-16819147 AACAGCCTGGAGGAGACCAAAGG - Intergenic
1144623048 17:16830578-16830600 AACAGCCTGGAGGAGACCAAAGG - Intergenic
1144706677 17:17373136-17373158 AACAGCCTGGAGAAGGGTGGAGG - Intergenic
1144748947 17:17634909-17634931 AACAGCATGGCAAAGACAGTGGG - Intergenic
1144808555 17:17983890-17983912 AACATCATTGAGAAGATCGAGGG + Exonic
1145015737 17:19396791-19396813 AGCAGAATGGAGAGGACAGAGGG - Intergenic
1147487009 17:40825893-40825915 AACAGCAGAGAGAAGACTTCTGG + Intronic
1147545746 17:41400147-41400169 AAGAGCTTGGAGAATACTGCTGG - Intergenic
1147573102 17:41583418-41583440 AACAGCCTGGAGGAGACCAAAGG - Exonic
1147577371 17:41610514-41610536 AACAGCCTGGAGGAGACCAAAGG - Exonic
1147659684 17:42110898-42110920 ACGATCAGGGAGAAGACTGAGGG + Exonic
1149149855 17:53548578-53548600 GACAACATGGATAAAACTGAAGG - Intergenic
1149423743 17:56534950-56534972 TACAGCATGAAGAAAACGGAAGG + Intergenic
1151010842 17:70494098-70494120 AACAACATGGAGGAGGCTGGAGG + Intergenic
1152062819 17:78091466-78091488 AACAGCATGGACATGACCGGTGG + Exonic
1152656327 17:81520744-81520766 ATCAGCAAGGAAAAGCCTGAAGG - Intronic
1153211939 18:2776846-2776868 AACAGCATGGGAAATCCTGACGG + Intronic
1155149151 18:23109071-23109093 AACATAAAGGAGAAGATTGATGG - Intergenic
1155435534 18:25808838-25808860 AGCAGCGTGGATAAGACTGGAGG + Intergenic
1156066723 18:33150717-33150739 AACAGTATGGAGAAGCTTTAAGG + Intronic
1156200590 18:34827157-34827179 ATCATCATGGAGAACACAGAAGG + Intronic
1156378681 18:36537359-36537381 AACAGCATGGAGAACCATTAAGG - Intronic
1157505602 18:48224023-48224045 AAGATGATGGAAAAGACTGACGG + Intronic
1158408383 18:57180775-57180797 AACACCATGGATGAGCCTGAAGG - Intergenic
1159174522 18:64815583-64815605 AACACCATAGAAAAGTCTGAGGG - Intergenic
1160477869 18:79208979-79209001 AGCAGCATGAAGAAGGCTGGAGG - Intronic
1161811914 19:6476193-6476215 ACCTGCATGGGGAAGACTCAGGG - Intronic
1161970788 19:7578802-7578824 AAGAGCCTGGACCAGACTGAAGG - Intergenic
1163332242 19:16647256-16647278 AACAGCCTGGAGAAGTCAGAGGG + Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164912077 19:32021055-32021077 TACTGCAGGAAGAAGACTGAAGG + Intergenic
1165492887 19:36135348-36135370 GACAGCAGGGAGCAGACAGAAGG + Intergenic
1165646620 19:37444179-37444201 AACAGCATGAAGAAATCTGGAGG - Intronic
1167776031 19:51556922-51556944 CACAGCATGGATAAAACTGAAGG + Intergenic
1168254368 19:55157690-55157712 AGCAGCCCGGAGGAGACTGACGG - Exonic
1168465858 19:56600687-56600709 AACAACATGGATAAAACTGGAGG - Intronic
925635743 2:5940367-5940389 AATAGAATGGAGAAGGCTGGAGG - Intergenic
925687293 2:6485544-6485566 AAAAGCATGGAGAAAAGGGATGG - Intergenic
926000615 2:9329222-9329244 AACTGCATGGAAAAGCCTTAGGG + Intronic
926450170 2:12993925-12993947 GACAGCAGGGACAAAACTGAAGG - Intergenic
927052287 2:19342192-19342214 AACAGAATGGAGGGGACAGAGGG + Intergenic
927668279 2:25047242-25047264 AATAGCAAGGAGAGGGCTGAAGG - Intronic
928748975 2:34449230-34449252 AACAGCATGGATGACACTGGAGG - Intergenic
928845823 2:35670466-35670488 AACAACATGGAGGGAACTGAAGG - Intergenic
929008666 2:37419704-37419726 AAACCCAGGGAGAAGACTGAGGG + Intergenic
930316083 2:49798615-49798637 AACAGCATGCAGAAAAATGTTGG + Intergenic
931234240 2:60399896-60399918 GGCACCATGGAGAAGACTGAAGG + Intergenic
932178035 2:69620531-69620553 AAGAGCATTCAGAAGAGTGATGG - Intronic
933217161 2:79643866-79643888 AAAAGCATGGAAAAGAATGTGGG - Intronic
934021142 2:87954131-87954153 AAAAGCATGGTGGAGAATGATGG - Intergenic
934983229 2:98865008-98865030 AATCTCATGGAGAAGACTGGAGG + Intronic
935144283 2:100384235-100384257 AACATCTTGGTGAAAACTGAGGG + Intergenic
935320438 2:101882931-101882953 CACAGCGTGGGGGAGACTGAGGG - Intronic
935408165 2:102731392-102731414 AACAGCATAGAGAGTACTCAGGG + Intronic
937051479 2:118894924-118894946 AACTGCATGGAGAAGAGGGCTGG - Intergenic
937461075 2:122086499-122086521 AACAGTATGGAGATTACTCAAGG - Intergenic
938389723 2:130895227-130895249 AACAGCATGGTGAGGTCTCAAGG - Intronic
938737383 2:134198635-134198657 AACTACCTGGAGAAGACTAATGG + Intronic
938811567 2:134858228-134858250 AACAACATGAATAACACTGAAGG + Intronic
939872242 2:147538506-147538528 AACAGCCTAGAGGAGACTAAAGG - Intergenic
940285978 2:152033343-152033365 AACAACAGGGAGGGGACTGAGGG + Intronic
940990927 2:160095635-160095657 AACAACATGGATGAAACTGAAGG + Intergenic
941441645 2:165545118-165545140 AACACCATGGAGACCACTGGTGG + Intronic
942130873 2:172877810-172877832 AAAGGTATGGAGAAGACAGAAGG - Intronic
944325667 2:198400756-198400778 AATAGCAAGTAGAAAACTGAGGG - Intronic
946020997 2:216640027-216640049 GACAGCATGGAGAAGGCAGGAGG - Intronic
946127423 2:217575648-217575670 AACAACATGGATAAAACTGGAGG + Intronic
946232955 2:218303928-218303950 AGCAGGGTGGAGAAGACGGAGGG - Intronic
946714315 2:222537127-222537149 AACAGCATGAAGAATACAGGAGG - Intronic
948316632 2:237032238-237032260 CACAGGATGGAGCAGAGTGAGGG - Intergenic
948343925 2:237279415-237279437 CACAGCATGGAGCATACTGATGG + Intergenic
948912894 2:241013711-241013733 AACAACATGGATGAAACTGAAGG - Intronic
1168826896 20:820007-820029 AAGAGGAAGGAGAAGGCTGAGGG - Intergenic
1168899340 20:1348271-1348293 AACAACATGGATGAAACTGAAGG - Intronic
1169247880 20:4038188-4038210 AGCAGCTTGGAGAAGACAGGGGG + Intergenic
1169413839 20:5398718-5398740 AAAGGCATGGAGAATATTGAGGG + Intergenic
1169534200 20:6519655-6519677 AACAGCATGAAAAAGACTATTGG - Intergenic
1169651641 20:7874758-7874780 AACAGCATGGATAGGACCGGAGG + Intergenic
1170431098 20:16277710-16277732 AAGAGCATTGCGAAAACTGAAGG + Intronic
1170888822 20:20363156-20363178 AAGAGCAGGGAGAAGAGTGGGGG + Intergenic
1172617732 20:36300278-36300300 AAGAGCAAGGGGAAGACAGAGGG - Intergenic
1172735124 20:37120956-37120978 AACATCATGGAAAAGAATAAAGG - Exonic
1174076674 20:47942282-47942304 CACAGCATAGAGAATGCTGAGGG + Intergenic
1174588738 20:51628425-51628447 AACAGAATGGGCAAGAGTGAGGG + Intronic
1175865526 20:62174235-62174257 ACCAGCATGGCGAGGGCTGATGG - Intronic
1176175499 20:63721425-63721447 AACAGCCTGGCGGACACTGAAGG - Intronic
1177035656 21:16039352-16039374 GGCAGCAAGGAGAAGAATGAGGG + Intergenic
1177231233 21:18322574-18322596 AACAACATGGAGGAAACTGGAGG + Intronic
1177646301 21:23903683-23903705 AACAGCAAGGAGAAGGGAGAGGG + Intergenic
1178816749 21:35937277-35937299 CACAGATTGGAGAAGACTAAGGG + Intronic
1178883457 21:36466446-36466468 AGCAGGAAGGAGAAGAATGAGGG + Intronic
1179331469 21:40406492-40406514 AACAACATGGATAAACCTGAAGG + Intronic
1179449417 21:41458362-41458384 ACCACCATGGAGGAGATTGATGG + Intronic
1180944289 22:19681227-19681249 AAAAAAATAGAGAAGACTGATGG + Intergenic
1181159165 22:20946991-20947013 AACAGCATGAAGAATGATGATGG + Intronic
1184725084 22:46339800-46339822 AACAACATGGACAAAACTGATGG + Intronic
1185260484 22:49859084-49859106 AACAGCATGTGGAGGTCTGATGG - Intronic
949144353 3:678885-678907 AACAACATGGATAGAACTGAAGG - Intergenic
949665740 3:6337525-6337547 AACAGCAAGAAGAACAATGAAGG + Intergenic
949795811 3:7849533-7849555 AACAGTATGGAGAAATGTGATGG + Intergenic
950558023 3:13706825-13706847 AAGCACATGGAGAAAACTGAGGG + Intergenic
950558385 3:13708435-13708457 AACCACGTGGAGAAAACTGAGGG + Intergenic
951392543 3:22124221-22124243 AACAGCATGGATGAAGCTGAAGG - Intronic
955084168 3:55686880-55686902 AAAAGCATGCAGATGACTGATGG - Intronic
955271715 3:57506154-57506176 AACAACATGGTAAAGACTGAAGG + Intronic
955830209 3:62993314-62993336 AACAGAATGGAGAAGACTTCCGG - Intergenic
956558022 3:70542939-70542961 AATACCATGGAGAAGTCTGGGGG + Intergenic
957323693 3:78664787-78664809 CACAGCAAGGAGAAAAATGAGGG - Intronic
957834215 3:85565693-85565715 TACAGCTTAGAAAAGACTGATGG - Intronic
960431685 3:117576905-117576927 ATCAGGAAGGAGAAGAATGAGGG - Intergenic
960873397 3:122273704-122273726 TACAGCATGGAGAAGGATGATGG + Intronic
960956063 3:123031984-123032006 ACTAGGATGGGGAAGACTGAGGG - Intergenic
961920408 3:130419121-130419143 AACAGCAAGCAGGAGAATGAGGG + Intronic
965552969 3:169988336-169988358 AACAGCAAGGAGAAGAATACTGG - Exonic
966153152 3:176887880-176887902 AACAACATGGATAAAACTGGAGG + Intergenic
966476273 3:180351178-180351200 AACAGCATGGATGAAACTGTAGG - Intergenic
967549122 3:190768699-190768721 AACAACATGGATGAAACTGAAGG - Intergenic
967696410 3:192537094-192537116 AACAGCATGAATAGGACTGGAGG - Intronic
968858753 4:3149712-3149734 CAGAGAAGGGAGAAGACTGATGG - Intronic
969069717 4:4526004-4526026 AGCAGCATGGTGAAAACTGGTGG + Intronic
970199911 4:13593707-13593729 ATCAACATGGAAATGACTGATGG - Intronic
970816701 4:20164897-20164919 AACAGCTTGGGGATGAATGAGGG - Intergenic
971449852 4:26789635-26789657 AACAGTATGGAGACGTCTCAAGG + Intergenic
972121939 4:35713687-35713709 AACAGCATGGAGACAACTTCAGG + Intergenic
973836552 4:54815846-54815868 AGCAGAATGGAGAAGAATGGAGG - Intergenic
973960986 4:56109425-56109447 CACAGGTTGGAGGAGACTGAGGG + Intergenic
974926095 4:68299620-68299642 AACAGTATGGAGGAAACTGGAGG - Intergenic
975375591 4:73640493-73640515 AACACAATGGAGAACACTGTTGG - Intergenic
977493478 4:97742618-97742640 AACAACATGGATGAAACTGAAGG + Intronic
977873111 4:102117137-102117159 AACAACATGGATAGGACTGGAGG - Intergenic
978057321 4:104287540-104287562 GACAGCATGGATAAAACTGGAGG - Intergenic
978462409 4:108970844-108970866 AACAGCATGGATGAACCTGAAGG - Intronic
978675380 4:111308585-111308607 AAAAGCATGCAGAAAGCTGAAGG - Intergenic
980204744 4:129702816-129702838 AACAGCCCGGAGAAGAAAGATGG - Intergenic
980559838 4:134459071-134459093 CACAGAAAGGAGAAGAATGAAGG - Intergenic
980562514 4:134496250-134496272 AACAACATGGATTATACTGAAGG + Intergenic
980799227 4:137727364-137727386 AACACCATGGATGAAACTGAAGG - Intergenic
980897481 4:138874112-138874134 AGCAGCATGGAGAAGGCAGCTGG - Intergenic
981140704 4:141265476-141265498 AACAGCATGGATGAAACTTAAGG + Intergenic
982901513 4:161009984-161010006 CTCAGGATGGAGAAAACTGAAGG - Intergenic
983231027 4:165129012-165129034 AACAGTGAGGAGAAGGCTGAGGG + Intronic
983404726 4:167313559-167313581 AACAGCATGGAGATTTCTAAAGG + Intergenic
983463988 4:168063576-168063598 AACAACATGGATAAAACTGGAGG + Intergenic
983693475 4:170500603-170500625 AAGAACATGGAGAAGAATGTGGG - Intergenic
983942988 4:173555748-173555770 AACAACATGGATAAAACTGGAGG + Intergenic
985061343 4:186082313-186082335 AACACCCTGGAGAAAACTAAAGG - Exonic
986108659 5:4687917-4687939 ACCAACATGGAGAAAACAGAGGG + Intergenic
986545431 5:8891887-8891909 AGCAGGAGGGAGAAGAATGAAGG + Intergenic
986616841 5:9626185-9626207 ATCAGCCTGAAGAAGACGGATGG + Intergenic
986649346 5:9948259-9948281 AGCAGCAAGGAGAGGCCTGAAGG - Intergenic
987240052 5:15987214-15987236 AACAACATGGATAAACCTGAAGG - Intergenic
987264637 5:16240210-16240232 AACAACATGGATAAAACTGGAGG + Intergenic
987713793 5:21539447-21539469 AACAGCATGGAGAAACCTGAAGG + Intergenic
987868162 5:23573591-23573613 AACAACATGGATAATACTGGAGG - Intergenic
988265002 5:28937595-28937617 AACAACATGGATTAAACTGAAGG - Intergenic
989693100 5:44169498-44169520 AAGAGAATGGAGAAAAGTGAGGG + Intergenic
989992760 5:50787353-50787375 AACAGCTTGGAGAACAGTGTAGG - Intronic
990990855 5:61682501-61682523 AACAGCCTGGAGCAGATTAAAGG - Intronic
990994615 5:61719285-61719307 AACCACATGGAGAAGAATGGAGG + Intronic
991654335 5:68888349-68888371 AACAACATGGATAAACCTGAAGG + Intergenic
992819534 5:80482300-80482322 AACACAATGAAGATGACTGAGGG + Intergenic
992944724 5:81798789-81798811 TACAGTATGGAGAGGACTGCAGG - Intergenic
994176310 5:96715302-96715324 AACAGCTTGCACAAGACTTAGGG - Intronic
994228362 5:97281925-97281947 AGCAACATGGATAAAACTGAAGG - Intergenic
994732412 5:103508124-103508146 GACAGCATGGGGCAGACGGAGGG + Intergenic
995417498 5:111926730-111926752 AAAAGGAGGGAGAAGACTAAGGG - Intronic
995533487 5:113113419-113113441 AACACCAAAGAGAAGACTGAAGG + Intronic
996079988 5:119247011-119247033 AAAAGTATGGAGAAGACCAAAGG - Exonic
997096383 5:130918079-130918101 AACAACATGGATAGAACTGAAGG + Intergenic
997580757 5:135015386-135015408 ACCAGCATGGAGGAGAATGCAGG - Intergenic
998254467 5:140574004-140574026 AGCAGCCTGGAGCAAACTGAGGG + Intronic
998680474 5:144461236-144461258 AAAAGCATGGAAAAGACTGATGG + Intronic
998894805 5:146788086-146788108 AACGGCATGGAGGAGGCAGAGGG - Intronic
999373831 5:151072628-151072650 AACAGTATAGAGAAGGCTGCAGG - Intronic
1000215170 5:159148329-159148351 AACAACATGGAGGAACCTGAAGG + Intergenic
1001006373 5:168054280-168054302 AGCAGCAGGGTGAAGGCTGATGG + Intronic
1001270601 5:170308567-170308589 AAGATCATGGGGAGGACTGAGGG - Intergenic
1002604528 5:180374621-180374643 AACAGGATGGAGAAAAGTGGAGG + Intergenic
1003442349 6:6154933-6154955 CATACCATGGAGAAGACAGATGG - Intronic
1003706422 6:8536296-8536318 AACAGCAAGGAGGCGAGTGAGGG + Intergenic
1004429344 6:15529861-15529883 AACGGCATGGAGAGGCCTGTGGG + Intronic
1005155683 6:22803544-22803566 AACAGCATGAGCAAGACTGAAGG + Intergenic
1005907079 6:30271950-30271972 AACAACATGGATAAATCTGAAGG + Intergenic
1008853509 6:56053318-56053340 AACAGAATGGGGAACACAGAGGG - Intergenic
1009002924 6:57742448-57742470 AACAGCATGGAGAAACCTGAAGG - Intergenic
1009551378 6:65097698-65097720 AACAACATGGATAAACCTGAAGG + Intronic
1009742848 6:67769804-67769826 AAAAGCAGGGAGAAAACAGAAGG - Intergenic
1009894166 6:69726574-69726596 AACAGCATGGATAGAACTGGAGG + Intronic
1010485324 6:76404849-76404871 AACAGCATGAATGAGACTGGAGG - Intergenic
1011575258 6:88790527-88790549 AAGAGCAGGCAAAAGACTGAAGG + Intronic
1012039789 6:94189573-94189595 AACATCAGGAAGAAGACGGAAGG + Intergenic
1013263646 6:108472037-108472059 AACAACATGGATAAAACTGGAGG + Intronic
1014130034 6:117820374-117820396 AACACTATAGAGAAGATTGAGGG + Intergenic
1014328541 6:120030047-120030069 AACAACATGGATAGAACTGAAGG + Intergenic
1014331366 6:120069328-120069350 AACAACATGGATGAAACTGAAGG - Intergenic
1014375237 6:120664178-120664200 AACAACATGGATAAAAGTGAAGG - Intergenic
1014483124 6:121963298-121963320 AACAATATGGACAAGAGTGAGGG - Intergenic
1014976931 6:127898816-127898838 AACAACATGGATAGAACTGAAGG + Intronic
1015151041 6:130038068-130038090 GACAGCATGGATAAGCCTGAAGG - Intronic
1015735476 6:136394861-136394883 AACAACATGGATAAAACTGCAGG - Intronic
1017194564 6:151685610-151685632 AAGAGTGGGGAGAAGACTGAGGG + Intronic
1017410468 6:154162426-154162448 AACAACATGGAGGTCACTGATGG - Intronic
1017581541 6:155870227-155870249 CACAGCAAGGAGAACATTGATGG - Intergenic
1018226705 6:161636022-161636044 ACCAGGATGGAGAGGACTGAAGG - Intronic
1018512192 6:164536784-164536806 AACAGCATGGAGGATAAGGAAGG - Intergenic
1018589533 6:165403868-165403890 AGCAGCATGGATGAAACTGAAGG - Intronic
1020140153 7:5607437-5607459 AGCAGCTGCGAGAAGACTGAGGG + Intergenic
1020607216 7:10354577-10354599 AACAACATGGATAAAACTGGAGG - Intergenic
1020850003 7:13340974-13340996 AACAGCATGGAGATTCCTTAAGG - Intergenic
1021391433 7:20097768-20097790 AACAGCATGGATAAACCTGGAGG + Intergenic
1021435525 7:20610149-20610171 AACAACATGGAGAAACCTGGAGG + Intergenic
1021629939 7:22634968-22634990 ATCAGCAGGGAGAAGAAGGAAGG + Intergenic
1021789466 7:24189131-24189153 AAATGCATGGAGTAAACTGATGG - Intergenic
1024980050 7:55150627-55150649 ATCAGTATTGAGAAGTCTGAAGG - Intronic
1025172059 7:56768005-56768027 AACAACATGGATAAAACTGGAGG + Intergenic
1025699808 7:63807550-63807572 AACAACATGGATAAAACTGGAGG - Intergenic
1026531068 7:71197740-71197762 AACAACATGGATAAAACTGGAGG - Intronic
1026581793 7:71624506-71624528 AAGAGAATGGAGAAAAATGATGG + Intronic
1028182573 7:87743375-87743397 AACAGCATGGAGATTCCTTAAGG - Intronic
1029021417 7:97368705-97368727 AACAACATGGATAGGACTGGAGG + Intergenic
1030211538 7:107001160-107001182 AACACCAGGGAGAAAACGGAGGG - Intergenic
1030506030 7:110423651-110423673 CACAGCTTGGAGGAGAGTGAGGG - Intergenic
1030609278 7:111671085-111671107 AAAAGGATGGATAAGACTGCAGG - Intergenic
1031217497 7:118914492-118914514 AGCAACATGGATAAAACTGAAGG + Intergenic
1033800528 7:144896592-144896614 GACAGCATGGATGAAACTGAAGG + Intergenic
1034777153 7:153838509-153838531 AACAGCAAGGTGAAGACAAAGGG + Intergenic
1036019357 8:4826392-4826414 AACAGCATGGATGAGCCTGGAGG + Intronic
1036405239 8:8448950-8448972 AACAGTATGGAGATTCCTGAGGG - Intergenic
1037687328 8:21153398-21153420 AACAACATGGATGAAACTGAAGG + Intergenic
1038363552 8:26907725-26907747 CACCTCATGGAGAACACTGAGGG - Intergenic
1039042417 8:33420431-33420453 AACACGAATGAGAAGACTGATGG + Intronic
1039100174 8:33932824-33932846 AACAACATGGATGAAACTGAAGG - Intergenic
1039153970 8:34534736-34534758 TACAGCATGGAGGACACTGATGG - Intergenic
1039503029 8:38031593-38031615 AGCAGCGTGGAGGAGAATGAAGG - Intronic
1039782379 8:40797999-40798021 AAGACCCTGGAGAAGAGTGAAGG - Intronic
1041191411 8:55359164-55359186 AAAAGCACGGAGAAGGCAGAAGG + Intronic
1042009108 8:64219728-64219750 AACAACATGGATAAACCTGAAGG + Intergenic
1042015206 8:64301602-64301624 AAAAGCAAGGAGAGGAATGAAGG - Intergenic
1042631041 8:70816324-70816346 AACAGTATGGAGATTTCTGAAGG + Intergenic
1043374071 8:79627898-79627920 GACAACATGGATAAGCCTGAAGG - Intronic
1043824431 8:84908493-84908515 AACACCATGGATAAGCCTGGAGG - Intronic
1044557543 8:93579955-93579977 AAAAGCATGAAGAGGTCTGAGGG + Intergenic
1044915997 8:97113093-97113115 AAGCCCATGGAGAAGACTGCGGG + Intronic
1045425648 8:102063563-102063585 AACAGCATGGAGGCAACAGATGG - Intronic
1046371249 8:113309797-113309819 AACAGCATGGAGAAGACTGAGGG - Intronic
1046531703 8:115454196-115454218 GCCAGCATGGAGGACACTGATGG - Intronic
1047609923 8:126510770-126510792 AACAGCACGGAGGAATCTGAAGG + Intergenic
1048460744 8:134619762-134619784 ACCAGGATGGTGGAGACTGAGGG - Intronic
1049485805 8:142859744-142859766 AACAGTATGGAGATGTCTCAAGG - Intronic
1050325728 9:4495638-4495660 AACATCAAGGAGTAGAATGAGGG + Intronic
1050438445 9:5634021-5634043 AACAACATGGACAAAACTTAAGG - Intronic
1050691219 9:8228741-8228763 ATCAGAATGGAGAAGACTACAGG + Intergenic
1051110848 9:13633863-13633885 AACAGCATGGATAGAACTGGAGG + Intergenic
1051306717 9:15717947-15717969 AACAGCAGAGAGAAGAATAAAGG + Intronic
1051821537 9:21175394-21175416 TACAGATTGGAGGAGACTGAAGG - Intergenic
1052246240 9:26338789-26338811 AACAGCATGGAGAAAACATCAGG - Intergenic
1052454643 9:28680257-28680279 AACAGCATTGATGAGCCTGAGGG - Intergenic
1053552266 9:39096062-39096084 AACAGCACAGAGGAGACAGATGG - Intronic
1053816394 9:41916223-41916245 AACAGCACAGAGGAGACAGATGG - Intronic
1054106654 9:61059905-61059927 AACAGCACAGAGGAGACAGATGG - Intergenic
1054614203 9:67271220-67271242 AACAGCACAGAGGAGACAGATGG + Intergenic
1055014972 9:71606401-71606423 AAGAGAATGCAGAAGACAGAAGG + Intergenic
1055172504 9:73276173-73276195 GACAGCAATGTGAAGACTGAGGG + Intergenic
1056202160 9:84287366-84287388 AACAGAGTGGAAAAGACTAAGGG - Intronic
1056241245 9:84648767-84648789 CACAACATGGAGGAGTCTGAAGG - Intergenic
1056254370 9:84783656-84783678 AAGAGCATGGAGAAGAGAGAGGG + Intronic
1057963800 9:99483039-99483061 AACAGCGTGGATAAACCTGAAGG - Intergenic
1058363834 9:104183850-104183872 AACAGATTGAAGGAGACTGATGG - Intergenic
1058954250 9:109930811-109930833 ACCAGCAGGGGGAAGAGTGAAGG + Intronic
1059374342 9:113870668-113870690 AAGGGCATGGAAAAGAATGAAGG - Intergenic
1059969700 9:119652820-119652842 AACTGCATGGACCAGTCTGAGGG + Intergenic
1061651331 9:132052805-132052827 AACAGCATGGATAGAACTGGAGG - Intronic
1062164304 9:135099235-135099257 AACAGCTTGGTGAGGACGGATGG - Intronic
1062481784 9:136755716-136755738 AACAGCATGGGGAACAGTGCAGG + Intronic
1062481798 9:136755776-136755798 AACAGCATGGGGAACAGTGCAGG + Intronic
1062481803 9:136755800-136755822 AACAGCATGGGGAACAGTGCAGG + Intronic
1062481816 9:136755871-136755893 AACAGCATGGGGAATAGTGCAGG + Intronic
1062481828 9:136755931-136755953 AACAGCATGGGGAACAGTGCAGG + Intronic
1062481841 9:136756002-136756024 AACAGCATGGGGAATAGTGCAGG + Intronic
1062481845 9:136756026-136756048 AACAGCATGGGGAACAGTGCAGG + Intronic
1062481857 9:136756086-136756108 AACAGCATGGGGAACAGTGCAGG + Intronic
1062481878 9:136756206-136756228 AACAGCATGGGGAACAGTGCAGG + Intronic
1062481891 9:136756277-136756299 AACAGCATGGGGAATAGTGCAGG + Intronic
1062481907 9:136756373-136756395 AACAGCATGGGGAACAGTGCAGG + Intronic
1062481914 9:136756421-136756443 AACAGCATGGGGAACAGTGCAGG + Intronic
1186084985 X:5977814-5977836 AATGTCATGGAAAAGACTGAGGG - Intronic
1188365549 X:29310462-29310484 GACAGCATGGGGAAGGCTAATGG + Intronic
1188706775 X:33343386-33343408 AACAACATGGATAGAACTGAAGG + Intergenic
1189527957 X:41846271-41846293 AACAACATGGATAGGACTGGAGG + Intronic
1190602509 X:52107332-52107354 AACAACATGGATGAAACTGAAGG - Intergenic
1191767790 X:64719017-64719039 AGCAACATGGATAAGACTGGAGG + Intergenic
1191963075 X:66725202-66725224 AACAACATGGATGAGACTGGAGG + Intergenic
1192891284 X:75393577-75393599 AATAGTATGGAGAACACTGATGG - Intronic
1192893277 X:75412771-75412793 AACAACATGGATGAGACTGGAGG + Intronic
1193459252 X:81771046-81771068 AACAACATGGACAGAACTGAAGG + Intergenic
1193498758 X:82245484-82245506 AACAACATGGATGAAACTGAAGG + Intergenic
1193681581 X:84525854-84525876 AACAACATGGATAAACCTGAAGG + Intergenic
1193765300 X:85521486-85521508 AACAACATGGATAAAACTGGAGG - Intergenic
1194036797 X:88884976-88884998 AGCAGCATGGATCAAACTGAAGG - Intergenic
1194068552 X:89291905-89291927 AACAACATGGATAGAACTGAAGG - Intergenic
1194827423 X:98579796-98579818 AACAGCATGGAGATTCCTTAAGG - Intergenic
1194979331 X:100424354-100424376 AACAGCAGGGACAAGCTTGAGGG - Intergenic
1195399640 X:104447682-104447704 AACAGCATGAAGACTACAGATGG - Intergenic
1195434866 X:104830585-104830607 AACAACATGGACAAAACTGATGG - Intronic
1196144241 X:112299099-112299121 AGCATCATTGAAAAGACTGAGGG - Intergenic
1198011153 X:132555755-132555777 AACAACATGGATCAGCCTGAAGG - Intergenic
1198219760 X:134588625-134588647 AGGAGCCTGGAGAATACTGAAGG + Intronic
1198508179 X:137322304-137322326 AACAACATGGAGGAAACTGGAGG + Intergenic
1198591851 X:138192198-138192220 AGCAGCATGCAGGAGAATGAAGG + Intergenic
1198636187 X:138703362-138703384 AACAGCCTGGAGAAAATGGAAGG + Intronic
1199123383 X:144084998-144085020 AAAAGCATGGTGGAGAATGATGG + Intergenic
1199340733 X:146674630-146674652 AACAGGATGGAAAAGATAGAGGG - Intergenic
1199350832 X:146797636-146797658 AGCAGCATGGATGAAACTGAAGG + Intergenic
1199945865 X:152666657-152666679 AGCAGAATGGAGAGGACAGAAGG + Intergenic
1201502759 Y:14663167-14663189 AACAACATGGATAAAACTGGTGG - Intronic
1201735473 Y:17256113-17256135 AATAGGATGGTGAAAACTGAGGG - Intergenic