ID: 1046373760

View in Genome Browser
Species Human (GRCh38)
Location 8:113348382-113348404
Sequence ATCACCAGGTTGTCTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046373760 Original CRISPR ATCACCAGGTTGTCTTTGTT TGG (reversed) Intronic
904010504 1:27387196-27387218 ATCACCAGGTGGCCTCTTTTAGG - Intergenic
907902181 1:58751027-58751049 TTCACCAAAGTGTCTTTGTTAGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909721702 1:78778437-78778459 ATCAACAGGCTGGCTTTGATTGG - Intergenic
910449743 1:87332838-87332860 ACCACCAGGTTTTATTTCTTGGG - Intronic
912625210 1:111200496-111200518 GTCACCAGTCTGTCTGTGTTAGG - Exonic
913974162 1:143440959-143440981 TTCACCATATTGTGTTTGTTAGG + Intergenic
914068551 1:144266573-144266595 TTCACCATATTGTGTTTGTTAGG + Intergenic
914110604 1:144699781-144699803 TTCACCATATTGTGTTTGTTAGG - Intergenic
915500619 1:156314126-156314148 TTCATCATGTTCTCTTTGTTGGG - Intronic
916570585 1:166022855-166022877 CTCCCCATGATGTCTTTGTTAGG + Intergenic
918589769 1:186227948-186227970 ATCACCATCTTGGTTTTGTTGGG - Intergenic
918781851 1:188709526-188709548 TTCACCAGGTTCTCATTGTGAGG + Intergenic
919416369 1:197315619-197315641 TTCAGCTGGTTGTCTTTGTTTGG - Intronic
923350157 1:233096875-233096897 ATCACCAGGTTGGCTTTTCATGG - Intronic
924812686 1:247416980-247417002 ATGAACAAGTTGGCTTTGTTTGG - Intronic
1066309590 10:34183524-34183546 ATCACCATGTTGGCCGTGTTAGG - Intronic
1066344124 10:34565784-34565806 ATCACCAGGTTATTTTTGAGGGG + Intronic
1067563343 10:47319616-47319638 ATCACCAGCTTTGCATTGTTGGG - Intergenic
1069204569 10:65665580-65665602 ATTACTAGGCTGTCTTTATTAGG + Intergenic
1071027472 10:81132581-81132603 ATGGCCAAGTTGTTTTTGTTTGG + Intergenic
1071070102 10:81681688-81681710 ATCACCATCTTGGTTTTGTTGGG + Intergenic
1072269344 10:93760613-93760635 ATCTCCACTTTGTTTTTGTTGGG + Intronic
1072533849 10:96344551-96344573 ATAACCAGGTTGCCTTATTTTGG - Exonic
1074877975 10:117629238-117629260 ATCCCAAGGTCGACTTTGTTAGG - Intergenic
1076394219 10:130126872-130126894 ATCACCGAGTTGTGTTTGTAAGG + Intergenic
1077803575 11:5567297-5567319 TTCACCAGGTTTTTTTTTTTTGG - Intronic
1079695528 11:23477621-23477643 ATCCCCACGTTGTTATTGTTAGG - Intergenic
1081122253 11:39281987-39282009 ATTACTACGTTGTCTTTATTAGG + Intergenic
1081911570 11:46703280-46703302 ATCAACAGGTTGTTTTGGTGGGG - Intronic
1083318761 11:61832495-61832517 ATGCCCAGGTTGCCTTTGTAGGG + Intronic
1085204208 11:74720844-74720866 ATCAGAAGGTTTTCTTTGTAAGG + Intronic
1087093033 11:94294570-94294592 ATCACTTTGTTGTCTTTATTTGG - Intergenic
1088944696 11:114497921-114497943 ATAAACAGGTTTTCTTTTTTGGG + Intergenic
1089734487 11:120540286-120540308 ATTACCAGGGTGTCTTCCTTAGG + Intronic
1090527306 11:127551320-127551342 ATGACTAGGTTTTATTTGTTGGG + Intergenic
1090588510 11:128239372-128239394 ATCAGAAGGTGGGCTTTGTTTGG - Intergenic
1091542550 12:1475205-1475227 ATCATCAGATTGTTTTGGTTTGG + Intronic
1091919326 12:4291685-4291707 ATCACCAAGTTTTCTCTGCTGGG - Intronic
1093116099 12:15212986-15213008 ATCACAAGCTTGTTTGTGTTTGG + Intronic
1093252738 12:16827601-16827623 ATCACCACATTGTCTTTATGTGG - Intergenic
1095921481 12:47535794-47535816 ATGACCATGTTGTCTTTTTTTGG - Intergenic
1098158638 12:67625865-67625887 ATGACCTAGTTGTCTTTATTTGG + Intergenic
1099647127 12:85371936-85371958 TTCATCTGGTTGTCTTTCTTTGG + Intergenic
1100572303 12:95854282-95854304 AATACCAGGTTTCCTTTGTTGGG + Intergenic
1103635577 12:122302432-122302454 ATCACCAGGGTATTTTTTTTGGG + Intronic
1104319979 12:127741896-127741918 ATCACCATCTTGGTTTTGTTGGG + Intergenic
1106557647 13:30823985-30824007 TTCACCAGGATGCCTTTGCTAGG - Intergenic
1108363540 13:49688869-49688891 ATGCCCATGTTGTCTTTGCTTGG - Intronic
1108459342 13:50649576-50649598 ATCACCATCTTGTTTTTATTGGG + Intronic
1108924898 13:55730103-55730125 AACCCCAGGCAGTCTTTGTTGGG + Intergenic
1109575848 13:64257159-64257181 ATCTCCATTATGTCTTTGTTAGG - Intergenic
1109783660 13:67146463-67146485 ATCATCCTGTTGTGTTTGTTTGG - Intronic
1109839263 13:67901709-67901731 AACACCAGTTTGTATTAGTTTGG + Intergenic
1110164785 13:72427877-72427899 ATCTTCAGGTTTTCTTTTTTAGG + Intergenic
1113140418 13:107142062-107142084 ATCATCATATTGTCTTTGTATGG + Intergenic
1113794998 13:113051641-113051663 ATAACAAGGTTGTCTTAGTCCGG + Intronic
1114399130 14:22393324-22393346 AGCACCAGGTTTGCTTTGTCGGG - Intergenic
1115966326 14:38893073-38893095 GTCTCGAGGTTTTCTTTGTTGGG - Intergenic
1116490785 14:45500561-45500583 TTCACCAGGTTGTTTCAGTTAGG + Intergenic
1118075424 14:62293317-62293339 CTCATCAGGTTGTTTTTCTTGGG + Intergenic
1122810681 14:104286300-104286322 CTCTCCAGGGTGTCTTTGTTAGG + Intergenic
1123191695 14:106578271-106578293 ATTAATAGGTTATCTTTGTTTGG - Intergenic
1125174082 15:36800253-36800275 ATAACTAGGTTCTCTTTCTTTGG + Intronic
1126175342 15:45730613-45730635 ATTACCAGGTTGTCTTCTATAGG - Intergenic
1127146461 15:56029808-56029830 ATCACCAGGTTGTCTAAGGAGGG - Intergenic
1131609950 15:93950275-93950297 CTCACCAGGGTGTCTTATTTTGG - Intergenic
1134027918 16:10968470-10968492 ATCACCCAGTTTTCATTGTTGGG + Intronic
1134109379 16:11505360-11505382 ATAACCAGGTAGTCATGGTTGGG + Intronic
1144578277 17:16443549-16443571 CTCACCAGGGAGTCCTTGTTGGG - Exonic
1146876374 17:36415591-36415613 ATCACCATCTTGGCTTTGGTGGG + Intronic
1147063009 17:37897282-37897304 ATCACCATCTTGGCTTTGGTGGG - Intergenic
1147492624 17:40884724-40884746 ATCAAGAGGTTATCTATGTTAGG - Intronic
1148223502 17:45881902-45881924 ACCGGCAGGTTGACTTTGTTGGG - Intergenic
1148483001 17:47972201-47972223 ATCTCCAGGTTGTCTGTATGGGG + Intronic
1148588363 17:48797056-48797078 CTCACCAGGTTGTCTGTGCAAGG + Exonic
1152733198 17:81983606-81983628 ATCTCCAGCTTGGCATTGTTGGG - Exonic
1153230019 18:2926375-2926397 ATCTCCAGGTTGGCTTGGGTGGG - Intronic
1153862709 18:9230128-9230150 GTCCCCAGCTTTTCTTTGTTAGG + Intronic
1155548963 18:26944704-26944726 TTCAATAGGTTGTCATTGTTTGG - Intronic
1156320015 18:36011088-36011110 ATCTCCAAGTTTTTTTTGTTGGG + Intronic
1156382018 18:36571695-36571717 ATCAACTGGTTGTGTTTGTACGG - Intronic
1159367442 18:67486807-67486829 ATCTGCAGGTTTTCTCTGTTTGG + Intergenic
1159932444 18:74327601-74327623 ATTACAAGTTTGTCCTTGTTTGG + Intronic
1164283063 19:23786237-23786259 ATCACCACATTTTCTATGTTGGG - Intronic
1165088222 19:33366340-33366362 ATCACCTGCTAGTCTTTGTCAGG + Intergenic
1168120569 19:54250656-54250678 ATGTCCTGGTGGTCTTTGTTAGG + Exonic
927882969 2:26701571-26701593 ATCATCAGCCTGTCTTAGTTTGG + Intronic
933427333 2:82129661-82129683 ATCACCATGTTGGTTTTGGTGGG - Intergenic
933573722 2:84042900-84042922 ATTAAAAGTTTGTCTTTGTTTGG - Intergenic
934178866 2:89601931-89601953 TTCACCATATTGTGTTTGTTAGG + Intergenic
934289152 2:91676209-91676231 TTCACCATATTGTGTTTGTTAGG + Intergenic
935583331 2:104778793-104778815 AACACCAGGGTGGATTTGTTAGG + Intergenic
935606663 2:104978286-104978308 TTCACCTGGTTGTATTAGTTAGG + Intergenic
936729959 2:115370162-115370184 ACCACAAGGCTGTCTTTGATAGG - Intronic
938399820 2:130981194-130981216 ATTCCCAGGCTATCTTTGTTTGG - Intronic
940540811 2:155014123-155014145 ATAATCTGGGTGTCTTTGTTAGG - Intergenic
941706584 2:168664717-168664739 ATCACCATTTTGGCTTTGGTGGG + Intronic
944125615 2:196289565-196289587 ATCACCAGGTTGCCTAAGGTAGG + Intronic
1168879670 20:1195788-1195810 AGCACCTGTTTGTCATTGTTGGG + Intergenic
1170010293 20:11715306-11715328 AACAGCAGCTTGGCTTTGTTTGG - Intergenic
1177801311 21:25831583-25831605 ATCACCATGTTGGTTTTGGTGGG - Intergenic
1179106988 21:38409900-38409922 ATCACCAAGTTTTCTGTGATTGG - Intronic
1179200341 21:39212835-39212857 ATCATCTGGTAGTCTTTCTTTGG - Intronic
949100178 3:133846-133868 ATCACATGGTTGCCTTTTTTTGG + Intergenic
949907284 3:8868723-8868745 ATCACCAGATTATTTTTATTAGG - Intronic
951446997 3:22794329-22794351 TTCACCAGGTCCTATTTGTTTGG + Intergenic
952824189 3:37511199-37511221 AGAACCAGGTTTTTTTTGTTTGG - Intronic
953900727 3:46841029-46841051 ATCCACAGTTTTTCTTTGTTGGG - Intergenic
955404186 3:58615463-58615485 ATCAGCATGTTGTCTCTGTAAGG - Intronic
957368161 3:79253650-79253672 AACTCAAGTTTGTCTTTGTTTGG - Intronic
960849214 3:122035078-122035100 ATCACCAGGCTGGCTTGGTGAGG + Intergenic
962433115 3:135338532-135338554 ACCCCCAGGTTGTCTTGGGTGGG - Intergenic
964161380 3:153649540-153649562 CTCCCCAGCTTATCTTTGTTGGG - Intergenic
964483928 3:157167953-157167975 AAAACCAGGTTGTCTTTGAAAGG - Intergenic
968240996 3:197085197-197085219 CTCACCTGGTTGCCTTTTTTTGG + Intronic
971122637 4:23721286-23721308 ATAACCAGGTTTTCTTTGCAGGG - Intergenic
974713108 4:65629266-65629288 ATCACAAGGGTGACTTTCTTAGG + Intronic
978129987 4:105184523-105184545 GTCACCACTTTGTCTATGTTAGG + Intronic
979312288 4:119217418-119217440 GTGCCTAGGTTGTCTTTGTTAGG + Intronic
980476428 4:133323574-133323596 AGCACCAAGTTGTTTTGGTTTGG + Intergenic
981547948 4:145913891-145913913 ATCACCAGGAAGTCTTTACTAGG + Intronic
983137109 4:164098391-164098413 ATCACCAGGAAGTGCTTGTTTGG + Intronic
984357969 4:178689645-178689667 CTCACCAGGTTCTCTTGGTAAGG + Intergenic
985020916 4:185689449-185689471 ATCATCAAGTTGCCTTTGTGTGG + Intronic
987378427 5:17259763-17259785 ATCACCAGCCTGTCTTTGTCAGG + Intronic
992370027 5:76134097-76134119 ATCACCAGGGTTTCTGGGTTTGG - Intronic
992553053 5:77877344-77877366 AAAACCAAGTTGACTTTGTTTGG - Intergenic
995062459 5:107825903-107825925 AACACCAGGTTGGTTTTGTGGGG - Intergenic
995399720 5:111727226-111727248 ATCACCAGGTTGCCTTTGGGAGG - Intronic
997248488 5:132370885-132370907 ATGACCAGATTGTCGTTTTTGGG - Intronic
997465306 5:134084198-134084220 ATCAACAGGTTTCCTTTCTTGGG - Intergenic
998771614 5:145552135-145552157 AGGACCAGGTTGTCTTTCTTGGG + Intronic
1000773057 5:165381134-165381156 TTCATCAGGTTGTGGTTGTTTGG + Intergenic
1000979439 5:167800775-167800797 ATCTCCAGTTTCTCTTTGTCTGG + Intronic
1001043993 5:168357084-168357106 ATCACAAGTTTCTCTTTGTTGGG + Intronic
1003531159 6:6938723-6938745 ATCACCAGGTTGCCTAAGTAGGG - Intergenic
1003645156 6:7908952-7908974 ATTAACAGTTTCTCTTTGTTCGG - Intronic
1005306211 6:24516727-24516749 TTCACCAGGTTGTCTAGGTTGGG - Intronic
1006094146 6:31645244-31645266 ATCATGAGGTTTTCTTGGTTAGG - Intronic
1006131886 6:31874618-31874640 ATCACCAGGTTGGCTCTCCTGGG - Intronic
1010314122 6:74425515-74425537 ATCACAGGCTTTTCTTTGTTAGG - Intergenic
1013164720 6:107579342-107579364 GTCACCTGAGTGTCTTTGTTTGG - Intronic
1014174344 6:118315279-118315301 ATCAGCACCTTGACTTTGTTAGG - Exonic
1015507199 6:134001050-134001072 CCCAACAGGTTTTCTTTGTTTGG - Intronic
1015665867 6:135628021-135628043 ATCTCCATGTTATCTTTGGTGGG + Intergenic
1016387400 6:143542032-143542054 AGAACCAGATGGTCTTTGTTTGG - Intronic
1016514342 6:144877788-144877810 ATCACAGGGTGTTCTTTGTTAGG - Intergenic
1017568193 6:155711023-155711045 ATCTCCAGAGTGTCTTGGTTTGG + Intergenic
1018980574 6:168598868-168598890 ATCACCACATTGTCGTTCTTGGG - Exonic
1020398261 7:7742990-7743012 TGCACTAGGTTGTTTTTGTTTGG + Intronic
1020786577 7:12580866-12580888 ATCAACAGATTGTGTTTGTTTGG - Intronic
1021390127 7:20082684-20082706 ATTACCAGGTTGGATTTGGTAGG - Intergenic
1028002254 7:85513998-85514020 CTCACCAGGTTTTCTTTGTTAGG - Intergenic
1028540989 7:91941564-91941586 ATCATCAGCTTGTCTTCCTTAGG + Intronic
1029147684 7:98458472-98458494 ATCCCCAGGCTGACTTTGGTGGG - Intergenic
1029603495 7:101583991-101584013 AACACGGGGGTGTCTTTGTTTGG - Intergenic
1030815882 7:114036969-114036991 ATGTCCAGATTGTCTTTGTGTGG + Intronic
1030895606 7:115056070-115056092 ATTCTCAGATTGTCTTTGTTTGG + Intergenic
1032101261 7:128980128-128980150 ATCATCTGGTTTTCTTTATTTGG - Intronic
1032619429 7:133512670-133512692 CTCTCCAGTTTGTTTTTGTTTGG - Intronic
1034126901 7:148680780-148680802 GTCCCAAGGTTTTCTTTGTTGGG - Intergenic
1035275100 7:157743584-157743606 ATCTCCAGGTTGGCTGAGTTGGG + Intronic
1038500518 8:28039858-28039880 ACCACCAGGGTGACTGTGTTTGG + Intronic
1038535859 8:28352410-28352432 TTCACCAGGATGTCTTTCTCAGG + Intronic
1043349193 8:79339828-79339850 ATCACCAAGGTATCCTTGTTAGG + Intergenic
1043504736 8:80891145-80891167 ATCACAAGGTTGTCCTAGTGAGG - Intergenic
1046373760 8:113348382-113348404 ATCACCAGGTTGTCTTTGTTTGG - Intronic
1046618707 8:116504903-116504925 ACCCCCAGGATGTCTTTTTTCGG - Intergenic
1046840692 8:118853524-118853546 ATCACCAGGACTTATTTGTTAGG + Intergenic
1047243455 8:123116619-123116641 GTTACCAGGGTGTCATTGTTAGG - Intronic
1048267639 8:133001498-133001520 ATTACAAGGATGTCTTTATTTGG + Intronic
1050092879 9:2033230-2033252 ATCATCAGGTTGTATTGGTGAGG - Intronic
1050429508 9:5547986-5548008 ATCACCAAGTTGTTTTTTTGTGG + Intronic
1051877559 9:21807664-21807686 TTCAGCAGGTAGTCTTTTTTGGG - Intronic
1185884649 X:3771680-3771702 ATCACCAGCTTGGTTTTGGTGGG + Intergenic
1187499759 X:19830028-19830050 ATCACCATCTTGTTTTTGGTGGG + Intronic
1194024076 X:88729755-88729777 CTCAGTAGGTTGTGTTTGTTTGG - Intergenic
1197189582 X:123631068-123631090 AACACCTGGTTGTCTGTGGTTGG - Intronic
1199394869 X:147323774-147323796 ATCACCATGTTGATTTTGCTGGG - Intergenic
1199994295 X:153010457-153010479 ATCACCATCTTGTTTTTGGTGGG + Intergenic
1200052259 X:153440552-153440574 ATTTCCAGTTTGTCTTTGTGCGG - Intergenic
1201920432 Y:19228051-19228073 ATCACCATCTTGGCTTTGGTGGG + Intergenic