ID: 1046376480

View in Genome Browser
Species Human (GRCh38)
Location 8:113388440-113388462
Sequence GTGACAAATCAGATGGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046376480_1046376482 -6 Left 1046376480 8:113388440-113388462 CCTTTGACCATCTGATTTGTCAC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1046376482 8:113388457-113388479 TGTCACGTAGCCCATTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046376480 Original CRISPR GTGACAAATCAGATGGTCAA AGG (reversed) Intronic
904243425 1:29166956-29166978 GGAGCAAATTAGATGGTCAAGGG - Intronic
904414455 1:30348827-30348849 GTGGAAGATCAGATGGTCATGGG + Intergenic
906441441 1:45849428-45849450 GTCACAGATCACATGGTCATAGG - Intronic
906522783 1:46477203-46477225 GGGACAAATCAGAGGGGCACAGG - Intergenic
907191416 1:52652080-52652102 TTGACCAATCAGATGATCAGAGG + Intronic
907668835 1:56456882-56456904 GTAACAAATCAGACGCCCAAAGG - Intergenic
911416931 1:97586719-97586741 GTGATAATTCAGATGGTGAGTGG - Intronic
916282420 1:163066508-163066530 GAGAGTAATCAGATGGTGAAGGG - Intergenic
917334901 1:173916693-173916715 GTGACAACTCAGATGAAGAAGGG + Intronic
917681253 1:177370290-177370312 GTGGAAGATCAGATGGTCATAGG - Intergenic
919853868 1:201692660-201692682 GTGACAAGTCAGGTGTTCACTGG + Intronic
924827828 1:247560225-247560247 GTAACAAAGCAGCTGGTGAATGG - Intronic
1063044283 10:2376343-2376365 TTGACTAATCAGATTGTAAAGGG + Intergenic
1064857402 10:19785299-19785321 GTCAAAGATCAGATGGTCATAGG - Intronic
1069457294 10:68562761-68562783 GAGACAAATCAGATGGGAGAAGG - Intronic
1073784202 10:106870538-106870560 GTGGAAGATCAGATGGTCATAGG - Intronic
1073999157 10:109351003-109351025 GTCAAAAATCAGATGGTTATAGG + Intergenic
1079940602 11:26675540-26675562 GTGAGAAAAGAGAAGGTCAAAGG + Intronic
1083200263 11:61117076-61117098 GAAACAAATCAAATGGTGAATGG + Intronic
1086077476 11:82869853-82869875 GTGACAAATCACATGCCTAATGG + Intronic
1086209380 11:84300170-84300192 GTGACTGATCAGATGGGAAAGGG - Intronic
1087563675 11:99824480-99824502 TTTACAAATCAGTTGGTCACTGG + Intronic
1090454026 11:126831822-126831844 TTGACATAACAGATGGCCAAGGG + Intronic
1091117942 11:133032034-133032056 GTTCAAAATCAGATGGTGAAAGG + Intronic
1091356187 11:134939645-134939667 CTGCCAAAACAAATGGTCAAAGG + Intergenic
1092063865 12:5573292-5573314 GTGGAAAATCCAATGGTCAAGGG + Intronic
1092518936 12:9246441-9246463 ATCACAAATCAGATGGTAGAAGG - Intergenic
1093015258 12:14148712-14148734 ATTACAAATCAGATGGAAAAAGG + Intergenic
1093689727 12:22096855-22096877 GTCAAAGATCAGATGGTCATAGG + Intronic
1094497415 12:30997123-30997145 AGGACAAATCAGCTGGTCCACGG - Intergenic
1096203398 12:49702670-49702692 GGGTCATATCAGAAGGTCAAGGG + Intronic
1096658947 12:53110511-53110533 AGGACAAATCAGAAAGTCAAGGG - Intronic
1097200182 12:57271738-57271760 GAGGCAAATCAGATCTTCAAAGG + Intronic
1097467255 12:59942728-59942750 CTGACAAATCAGATTTCCAAGGG + Intergenic
1097533464 12:60835699-60835721 GAGTCAGATCAGATGGTCAAAGG + Intergenic
1098447606 12:70582916-70582938 GTGACAAATAAGCTTGTGAAAGG + Intronic
1098826922 12:75308134-75308156 GTGACCAATCAGAGGCTGAAGGG - Intronic
1100055907 12:90509161-90509183 GTCAAAGATCAGATGGTCATAGG + Intergenic
1100186350 12:92144898-92144920 GTGACAAATCCGATGATTAATGG + Intronic
1100667121 12:96767213-96767235 ATGACAAATTCGATGGCCAATGG + Intronic
1100675220 12:96859106-96859128 GTTGAAAATCAGATGGTCATAGG - Intronic
1100694422 12:97076164-97076186 GTGTGAAAGCAGACGGTCAAAGG + Intergenic
1101563997 12:105887987-105888009 ATCATAAATCAGATGGTCTAAGG + Intergenic
1103086411 12:118064260-118064282 GTCACAGCTCAGCTGGTCAAAGG + Exonic
1105371148 13:19803304-19803326 GTCACTTATCAGATGGTCAAAGG - Intergenic
1105580174 13:21688189-21688211 GTGACAAATCAGAAGCTGAGTGG - Intronic
1107777663 13:43863778-43863800 GTGACAACCCAAATGGCCAAAGG + Intronic
1108371401 13:49772969-49772991 GTAACAACTCAAATGGCCAACGG + Intronic
1109715998 13:66223100-66223122 GTGACATATCACATGCTCGAAGG + Intergenic
1109885914 13:68544174-68544196 AAGAAAAATCAGATGTTCAAAGG + Intergenic
1111766311 13:92534397-92534419 GCGACAAAACAGTTGGGCAAAGG + Intronic
1114447293 14:22798768-22798790 TTGGCAACTCAGAGGGTCAAAGG - Intronic
1115539505 14:34406451-34406473 GTGAGTGATGAGATGGTCAATGG + Intronic
1115635414 14:35286274-35286296 GTGAAAAATAAGATGGGGAAGGG - Intronic
1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG + Intronic
1121915205 14:97832220-97832242 GTTTCAATTCAGATGGTCCAGGG - Intergenic
1125458185 15:39882220-39882242 ATGACAAATCACATGCTCAGAGG + Intronic
1128297853 15:66540181-66540203 GTGAAAATTCAGATGGTCTATGG - Exonic
1130827628 15:87565865-87565887 GTGACTAGTCAGATGGTTACAGG - Intergenic
1131217235 15:90548331-90548353 GGGAACAATCTGATGGTCAAGGG + Intronic
1135951582 16:26919247-26919269 TTGACTAATCAAATGATCAATGG + Intergenic
1141241197 16:82266719-82266741 GTGTCAATTCAGATGGTTGAGGG + Intergenic
1141268354 16:82517111-82517133 GTGACAAATCCGAAGGTTGATGG + Intergenic
1146313644 17:31790187-31790209 GGGACAAATCAGAGGGACAGTGG + Intergenic
1146408951 17:32565501-32565523 GTGACAAAGCAGATGATCGAGGG - Intronic
1146994393 17:37305807-37305829 ATGACAAATCAGCTGGGGAAAGG + Intronic
1147367936 17:39971584-39971606 GTGAGACAGCTGATGGTCAAAGG + Exonic
1150564135 17:66323511-66323533 GTGGAAAATCAGATTGTCAGAGG + Intronic
1151189504 17:72387889-72387911 GTCACGAGTCAGTTGGTCAACGG + Intergenic
1154498435 18:14979652-14979674 CTGCCAAAACAGATGGTCAAAGG - Intergenic
1156402319 18:36750774-36750796 GTCAAAGATCAGATGGTCATAGG + Intronic
1158337889 18:56433549-56433571 CTGAAAAATTAGTTGGTCAAAGG + Intergenic
1160002587 18:75040860-75040882 GTGACAAAGCACATGGAGAACGG + Intronic
1160048511 18:75409455-75409477 GTGACAAATGAGATGAAAAATGG + Exonic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1162612106 19:11764440-11764462 GTGAAAGATCAGATGGTTGAAGG + Intergenic
1163270045 19:16247678-16247700 GTGACAAATCAGATGGGGCGGGG - Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
925204378 2:1994008-1994030 GTGACAGATAAGGTGGGCAAAGG - Intronic
925497611 2:4469660-4469682 GTGACAAACCAGCTGTTGAATGG - Intergenic
927412230 2:22840001-22840023 GTGTCAAATTAGAGGGTCAAAGG - Intergenic
930218030 2:48717051-48717073 GGGGCAAATCAGATGGTCATTGG + Intronic
932963745 2:76445608-76445630 GTGAAAAATCATATTGTAAAAGG + Intergenic
933857452 2:86429422-86429444 GTGTCAAATCAGCTGGTCCTTGG - Intergenic
933878918 2:86648161-86648183 GTGACAAAGTAAAAGGTCAATGG - Intronic
934549801 2:95251821-95251843 GTGACAAATCACACTTTCAAAGG + Intronic
936443796 2:112580188-112580210 GTCAAAAATCAGATGGCCATAGG + Intergenic
937521429 2:122717342-122717364 GTCAAAGATCAGATGGTCACAGG - Intergenic
937699713 2:124850599-124850621 GAGACAAAACAGATGGTAAATGG + Intronic
939484368 2:142791617-142791639 GTCAAAGATCAGATGGTCATAGG - Intergenic
941861031 2:170280766-170280788 GTCAAAGATCAGATGGTCATAGG + Intronic
941982440 2:171473773-171473795 GTGATAGATCAGTAGGTCAAAGG - Intronic
944131343 2:196350592-196350614 GTAACAAATGAGAGGGACAATGG - Intronic
946470179 2:219952633-219952655 CTTACAATTCTGATGGTCAAAGG + Intergenic
946500768 2:220245055-220245077 GTGAAAAATCAGAGACTCAAAGG + Intergenic
947438339 2:230093133-230093155 GTCAAAGATCAGATGGTCATAGG - Intergenic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1170436637 20:16337397-16337419 GTGGCAAATGAGATGATCTAGGG + Intronic
1173109860 20:40176490-40176512 GGGAAGAATCAGATGGTCTAAGG + Intergenic
1173295998 20:41757911-41757933 GTGAAAAATCAGATGGTTGTAGG + Intergenic
1173474488 20:43349380-43349402 TTGAACAATCAGATGGTCAGAGG + Intergenic
1173546894 20:43904512-43904534 GTGACATTTCAGATGGTAACCGG + Intergenic
1177224862 21:18241495-18241517 GTGACAAATAGGATCTTCAAAGG - Intronic
1178424585 21:32469199-32469221 GTGAGAAATCAGATAATGAATGG + Intronic
950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG + Intergenic
951775242 3:26303076-26303098 GTCAAAGATCAGATGGTCATAGG + Intergenic
952809663 3:37390365-37390387 GTCAAAGATCAGATGGTCATAGG + Intronic
957382710 3:79453725-79453747 ATGAGACATCAGATAGTCAAAGG + Intronic
959035283 3:101355501-101355523 GTCAAAGATCAGATGGTCATAGG + Intronic
961811037 3:129521858-129521880 GTGACAGATCAGATGGTCCCTGG + Intergenic
962123689 3:132591295-132591317 GTCAAAGATCAGATGGTCATAGG + Intronic
964553369 3:157909595-157909617 GTGAAAAATAAAAGGGTCAAAGG + Intergenic
966453628 3:180090977-180090999 GTCAAAGATCAGATGGTCATAGG + Intergenic
966541973 3:181101887-181101909 GTTACAAAGAAGGTGGTCAAAGG - Intergenic
970250057 4:14104941-14104963 CTGATAAATGAGATGGTCAAGGG + Intergenic
974260955 4:59522865-59522887 GTAATAAATGTGATGGTCAAGGG - Intergenic
975155106 4:71062642-71062664 TTGCCAAATGAGATGGGCAAAGG - Intergenic
975297991 4:72756222-72756244 GTTAAAGATCAGATGGTCATAGG - Intergenic
975704890 4:77101865-77101887 GTGACAAGTTATATGGTCATGGG - Intergenic
982851828 4:160327156-160327178 GTCAAATATCAGATGGTCATAGG + Intergenic
982983907 4:162179324-162179346 ATGACAAATTATATGGTCACTGG - Intergenic
984064046 4:175026101-175026123 GTGACAAAGCAGATTGGAAAAGG - Intergenic
984605480 4:181780912-181780934 GTCAAAGATCAGATGGTCATAGG + Intergenic
985339089 4:188929571-188929593 GTGGCAAATCAGAGGATCACAGG - Intergenic
986234289 5:5893067-5893089 GTGTCATCTGAGATGGTCAAAGG - Intergenic
986930023 5:12806074-12806096 GTAACAAAACTGATGATCAACGG - Intergenic
987384695 5:17318277-17318299 GAGATATATCAGATGGACAAGGG - Intergenic
989276919 5:39599852-39599874 GTGACAAAGCAAGGGGTCAAAGG + Intergenic
990134188 5:52625420-52625442 GTCACAGATCAGATGGTTATAGG + Intergenic
990687122 5:58317141-58317163 GTGATAAATCAGAAAGGCAAAGG + Intergenic
992633122 5:78700754-78700776 ATGACAAATTAGGTGGCCAAAGG - Intronic
994836149 5:104855518-104855540 GTCAAAGATCAGATGGTCATTGG + Intergenic
995778703 5:115753354-115753376 GTGGAAGATCAGATGGTCATAGG + Intergenic
997762442 5:136462762-136462784 GTGAAAACTCAGATAGTCAGTGG - Intergenic
1000914761 5:167067325-167067347 GTGACAAAGCTTATGTTCAAAGG - Intergenic
1005678919 6:28185136-28185158 GGGAAAAATCAGCTGTTCAATGG - Intergenic
1008621684 6:53277304-53277326 GTGACAAAGCAGAAGGAAAATGG - Intronic
1009486580 6:64231409-64231431 GGGATGAATCAGATTGTCAAGGG - Intronic
1009810358 6:68654565-68654587 GTGACAGATCAGATATACAAAGG - Intronic
1010170291 6:72967084-72967106 GTGACAAAGGAGAAGGTCCATGG + Intronic
1010756341 6:79669877-79669899 GTGTAAAATCAGGTGGTCAAAGG + Intronic
1012143058 6:95647702-95647724 GTCAAAAATCAGATGGTTATAGG - Intergenic
1012393908 6:98773908-98773930 GTCACATTTCAGATGCTCAAAGG + Intergenic
1012722882 6:102769392-102769414 GTGGAAGATCAGATGGTCATAGG - Intergenic
1012958198 6:105593350-105593372 GTGACTTGTCAGATGGACAATGG + Intergenic
1012986790 6:105884317-105884339 GTGACAAATCGGTAGGTCCAAGG + Intergenic
1014667401 6:124256300-124256322 GTGAAAAATAAGATAGTTAAGGG + Intronic
1014776791 6:125520244-125520266 GAGAGAAATCGGATGATCAAGGG + Intergenic
1015139045 6:129909266-129909288 TTGTCAACTGAGATGGTCAATGG - Intergenic
1016941274 6:149484651-149484673 GTGAGAAATCAGATTGTTCAGGG + Intronic
1019086668 6:169484870-169484892 GTCAAAGATCAGATGGTCATAGG - Intronic
1021896849 7:25244600-25244622 GGGAGAACTCTGATGGTCAAGGG - Intergenic
1028349737 7:89831242-89831264 GAGACAAATCACATCCTCAATGG - Intergenic
1030718837 7:112844946-112844968 GTCAAAAATCAGATGGTCATAGG - Intronic
1031945138 7:127831674-127831696 GTGATGAAACAGATGCTCAAAGG + Intronic
1033776054 7:144613375-144613397 GTCAAAAATCAGATGGTTATAGG + Intronic
1034290017 7:149922993-149923015 TTTACAAATCAGATGCTGAAAGG + Intergenic
1037682774 8:21111326-21111348 GTTACAAGTCAGAAGGTTAAGGG - Intergenic
1039248578 8:35636274-35636296 GTCATAAAGGAGATGGTCAATGG + Intronic
1040986522 8:53300057-53300079 GTCAAAGATCAGATGGTCATAGG + Intergenic
1042976287 8:74473587-74473609 GTTACAGATCAGATGGTTATAGG + Intronic
1043602001 8:81951824-81951846 GAGACAAATCAGTTGGTATAAGG + Intergenic
1044213311 8:89576953-89576975 TTGACAAACAAGATGGACAAGGG - Intergenic
1044521824 8:93207471-93207493 GTCAAAGATCAGATGGTCATAGG - Intergenic
1044793923 8:95876974-95876996 GTCAAAGATCAGATGGTTAAAGG - Intergenic
1044834494 8:96282485-96282507 GTGAGAACTCAGATGGTTAGGGG - Intronic
1045676178 8:104610182-104610204 GTCAAAGATCAGATGGTCATGGG + Intronic
1045726635 8:105181357-105181379 GTCAGAGATCAGATGGTCATAGG + Intronic
1045950051 8:107841240-107841262 GCAACAAATCAGATGGGCTATGG - Intergenic
1046376480 8:113388440-113388462 GTGACAAATCAGATGGTCAAAGG - Intronic
1047820971 8:128520265-128520287 GTGACAAATCAAATGGCCAAAGG - Intergenic
1051302666 9:15669596-15669618 TTGAAAATTCAGATGGTTAATGG - Intronic
1052228508 9:26119046-26119068 GTTACAATTCTGATGCTCAATGG + Intergenic
1055365303 9:75537867-75537889 GTCAAAGATCAGATGGTCATAGG + Intergenic
1055699024 9:78920979-78921001 GAGAGAAATCAGAAGGACAAAGG - Intergenic
1056327556 9:85492563-85492585 ATAAAAAATAAGATGGTCAACGG + Intergenic
1059913123 9:119068353-119068375 GTTAAAAATCAGATGGTCGTAGG + Intergenic
1186670276 X:11759526-11759548 GTGACAAATCGGCTGGCCAATGG + Intronic
1187620697 X:21050399-21050421 GTCACAGATCAGATGGTTATAGG - Intergenic
1192311447 X:70018535-70018557 GTCAAAGATCAGATGGTCATAGG - Intronic
1193502423 X:82295884-82295906 AGGACAAATCAAATGATCAATGG - Intergenic
1193523716 X:82562724-82562746 GTCAAAGATCAGATGGTCATAGG - Intergenic
1194216967 X:91142488-91142510 GTGAAAGATCAGATGGTTATAGG - Intergenic
1195209164 X:102635231-102635253 GTCAAAAATCAGATGGTCGTAGG - Intergenic
1195769212 X:108331092-108331114 GTGACAAAACACATTGACAAAGG - Intronic
1196666472 X:118322333-118322355 ATGACAAATCAGCTGGGCATAGG + Intergenic
1198579092 X:138043803-138043825 GTTGAAAATCAGATGGTCATAGG - Intergenic
1198976773 X:142344443-142344465 GTCAAAGATCAGATGGTCATAGG - Intergenic
1199847254 X:151700402-151700424 GAGACAAGTCAGATGGGGAAGGG + Intronic
1199988287 X:152968311-152968333 GTGACAAACCAGATACTCTAGGG + Intronic